ID: 1036391168

View in Genome Browser
Species Human (GRCh38)
Location 8:8325405-8325427
Sequence CCCTCTAAACAGGAGCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036391168_1036391174 6 Left 1036391168 8:8325405-8325427 CCCTGCGGCTCCTGTTTAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036391174 8:8325434-8325456 CTTATCTTTTGGTTTCTGTGTGG No data
1036391168_1036391173 -5 Left 1036391168 8:8325405-8325427 CCCTGCGGCTCCTGTTTAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036391173 8:8325423-8325445 GAGGGCTAAGGCTTATCTTTTGG No data
1036391168_1036391175 29 Left 1036391168 8:8325405-8325427 CCCTGCGGCTCCTGTTTAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1036391175 8:8325457-8325479 CTTCTGTTTCTAATGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036391168 Original CRISPR CCCTCTAAACAGGAGCCGCA GGG (reversed) Intronic
900494025 1:2968125-2968147 CCCTGGAAACAGTAGCAGCATGG - Intergenic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
901068395 1:6505509-6505531 CCCTCTAAACACAAGCCACGGGG + Intronic
901125045 1:6923420-6923442 CCCTCTAAACAGGAACCTTGAGG - Intronic
901205387 1:7492012-7492034 GCTTCTAAACAGGAGGCTCAAGG + Intronic
904115204 1:28156825-28156847 CCCTGGAAACAGGACCCCCAAGG - Intronic
904616011 1:31750290-31750312 CCCTCTGAACAAGAGCAGCATGG - Intronic
911419847 1:97627063-97627085 CCCTCATAAAAGGAGCCTCAAGG - Intronic
918936093 1:190924377-190924399 CCATCTCAACAGGAGCCTCTGGG + Intergenic
922141231 1:222889393-222889415 CCCTTTAAACAGGAGGCTTAAGG - Intronic
923026573 1:230209197-230209219 CCCTCTGACTAGCAGCCGCATGG + Intronic
1064810685 10:19194813-19194835 CCCTGTAATCAGGACCCACAAGG + Intronic
1066319670 10:34289174-34289196 CCCTCAAAAAAAGACCCGCAGGG - Intronic
1069933943 10:71902309-71902331 CTCTTTAAACAGGAACCACATGG - Intergenic
1078868862 11:15325361-15325383 CATTATAAACAGGAGCCCCATGG - Intergenic
1079737386 11:24013526-24013548 CCCATGAAACAGCAGCCGCATGG + Intergenic
1081975983 11:47235149-47235171 CTCTCTAGACAGGAGCGGAAAGG - Intronic
1084443181 11:69187635-69187657 CCCTCAACTCAGGAGCCACAGGG - Intergenic
1084954309 11:72683385-72683407 ACATCCAAACAGGAGCCTCAGGG - Intergenic
1088743710 11:112787037-112787059 CACTCTCAACCGGAGCTGCAAGG - Intergenic
1091130673 11:133144357-133144379 CCCTCTAAACAAAAGGGGCAAGG - Intronic
1091601973 12:1923192-1923214 GCCTTTGAACAGGAGCCCCAGGG + Intergenic
1091844298 12:3643569-3643591 CCCTTTAGACAGGAGCCACTGGG - Intronic
1098520519 12:71430924-71430946 CACTCTAAACAGGAATCCCAAGG - Intronic
1101208466 12:102512766-102512788 CCTTCTAAACAGAAGGGGCAAGG + Intergenic
1102322367 12:111948217-111948239 CTCCCTCAACAGGAGCAGCAAGG - Intronic
1104654791 12:130566301-130566323 CCCTCTAGACAAGAGGTGCAAGG + Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1132678337 16:1129865-1129887 CCCTCTCCACAGCGGCCGCAGGG - Intergenic
1136336206 16:29612426-29612448 CCACCAAAACAGGAGCCCCATGG + Intergenic
1136590923 16:31217157-31217179 CCCTCCCAGCAGGAGCCACAGGG - Exonic
1138030739 16:53557705-53557727 CCCTCTCAACAGGAGTCCCTGGG - Intergenic
1140032687 16:71351032-71351054 CCCCCTACACAGGAGCCAGAGGG + Intergenic
1140253719 16:73317257-73317279 CCCTTTAAACAGAAGCCGGGGGG + Intergenic
1141710410 16:85695654-85695676 GTCTCTCAGCAGGAGCCGCAGGG - Intronic
1142005548 16:87688002-87688024 CCCTCCACACAGGACCCTCACGG + Intronic
1142036926 16:87868209-87868231 CCACCAAAACAGGAGCCCCATGG + Intronic
1142252930 16:89000970-89000992 CCTTCTAACGAGGAGCCACATGG + Intergenic
1144438623 17:15262302-15262324 GCCCCTAAACAGAAGCCCCAGGG + Intronic
1152911543 17:83008032-83008054 CGCTCTCAAGAGGAGGCGCAGGG + Intronic
1154175600 18:12086019-12086041 CCCACTCCACAGGAGCCGCTGGG - Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1161009719 19:1954399-1954421 CCCTCTGACCTGGGGCCGCAGGG - Intronic
1165025628 19:32959157-32959179 CCCTCTAAACAGGACACCAAAGG + Intronic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
925643432 2:6010070-6010092 TCCTCTAAAGAGGTGCTGCAAGG + Intergenic
928456587 2:31428184-31428206 CCCTCTAAAGAGCAGACCCAGGG - Intergenic
933776765 2:85775803-85775825 CCCTCCAGACACGAGCCACATGG - Intronic
936270412 2:111044438-111044460 CCCTCTAAAGCTTAGCCGCAGGG + Intronic
1173875106 20:46365311-46365333 CCCTCTGAACAGAAGGCTCAAGG + Intergenic
1177553220 21:22653563-22653585 CCCACTGAATAGGAGGCGCAAGG + Intergenic
1181282129 22:21727771-21727793 TCCTCTACACAGGTGCCCCAGGG - Intronic
1185247528 22:49781090-49781112 CCATCAACACAGGAGCTGCACGG + Intronic
1185281163 22:49970497-49970519 CCCTCTAGAAAGGACCAGCAGGG + Intergenic
950013602 3:9741059-9741081 CCCTCAAACCAGGATCAGCATGG + Intronic
950187809 3:10956198-10956220 CCCTGGGAACAGGAGACGCATGG - Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
965951537 3:174314308-174314330 CCCTTTAAAAAGGAGCTGCCAGG - Intergenic
979547148 4:121951502-121951524 CCCTCGCAGCGGGAGCCGCACGG - Exonic
985796101 5:1963389-1963411 CCCTATAAACAGAAGCTGTATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
1001633673 5:173194817-173194839 CTCCCTGAACAGGAGCCCCATGG - Intergenic
1004013493 6:11711242-11711264 CCATAGAAACAGGAGCTGCAAGG + Intergenic
1018206863 6:161444525-161444547 CCCACTAACCAGGGGCTGCAGGG - Intronic
1018804812 6:167250222-167250244 CCCTGGAAGGAGGAGCCGCAGGG - Intergenic
1019088950 6:169508921-169508943 CCCTCCACACAGCAGCCACATGG + Intronic
1019778548 7:2926507-2926529 CCCTCTGCACAGCAGCCGGATGG + Intronic
1020138371 7:5598989-5599011 CCCACTGCACAGAAGCCGCAGGG - Intronic
1021413588 7:20355976-20355998 CCCTCAAAACAGGGGGAGCAAGG - Intronic
1036391168 8:8325405-8325427 CCCTCTAAACAGGAGCCGCAGGG - Intronic
1036946076 8:13096097-13096119 CTCTCTGAACAGGACCCGAAAGG + Intronic
1046244816 8:111545361-111545383 CCCTCAAAACAGGAGCTGTCAGG + Intergenic
1057570240 9:96198775-96198797 CCCTCCAGACAGGAGCCGGCTGG + Intergenic
1189818021 X:44843921-44843943 CCATGGAAACCGGAGCCGCAGGG + Intergenic
1202106779 Y:21379075-21379097 TCCCCTAAACAGCAACCGCATGG - Intergenic