ID: 1036391252

View in Genome Browser
Species Human (GRCh38)
Location 8:8326043-8326065
Sequence CTGACCTTTCTGTTTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036391252 Original CRISPR CTGACCTTTCTGTTTTGAGG AGG (reversed) Intronic
900110544 1:1003717-1003739 CTGAGCGTGCTGTTTTGGGGTGG + Intergenic
900500201 1:3000752-3000774 CCGACCATTCTGTTTTGAAGGGG + Intergenic
901489156 1:9587952-9587974 CTTTCCTTTCTTTTTTGAGAAGG + Intergenic
901507517 1:9694527-9694549 CTGACTTTTATTTTTTGAGACGG - Intronic
902063981 1:13668689-13668711 CTTTTCTTTCTGTTTTGAGATGG + Intergenic
902588284 1:17455084-17455106 CCGACCTTTCGTTTTTGAGATGG - Intergenic
905583774 1:39101820-39101842 CTTTCCTTTCTTTTTTGAGATGG - Intronic
905949609 1:41938167-41938189 CTGACCACTCTATTTTGAGTAGG + Intronic
906349192 1:45042981-45043003 CTGTCCTCTAAGTTTTGAGGGGG - Intronic
906633625 1:47392978-47393000 CTGGCATTGCTTTTTTGAGGGGG - Intergenic
907006765 1:50922160-50922182 CTGGCCTTTTTTTTTTGAGACGG - Intronic
909075787 1:71048469-71048491 CTGACCTTTTTGTTGGGTGGTGG - Intergenic
909184133 1:72463694-72463716 TTGACCTTTGTTTTTTGAGAAGG + Intergenic
909292193 1:73897757-73897779 TTGACCTTCCTGTTTCGTGGAGG - Intergenic
909975109 1:82036811-82036833 TTGAACTTTCTTTTTTGTGGGGG - Intergenic
912991682 1:114493830-114493852 CTGGCTTTTCTTTTTTGAGATGG + Intronic
913140098 1:115932482-115932504 CTTACCTTTTTTTTTTGAGATGG - Intergenic
914454816 1:147826014-147826036 CTGACCCTTTTGTTTTCATGAGG - Intergenic
915425056 1:155818991-155819013 CTGGCCTTTTTGTTTTGAGATGG - Intronic
918380313 1:183947024-183947046 TTGACCTTTTTTTTTTGAGATGG - Intronic
919543541 1:198881611-198881633 TTGACTTATCTGTTTTGAAGTGG - Intergenic
920427099 1:205887199-205887221 CTGACCTTACTGTTTTAGGCTGG - Intergenic
920827637 1:209436584-209436606 CTGATATTTCTGTTTTATGGAGG + Intergenic
921712111 1:218383323-218383345 GTGACCTTTATTTTTTTAGGAGG + Intronic
922169415 1:223142628-223142650 CTGGCCTTTATGTTGAGAGGGGG - Intronic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
923433949 1:233950646-233950668 CTGCCATTTTTGGTTTGAGGTGG - Intronic
924180909 1:241437789-241437811 TTGACCTTACTGTTTTAAGCTGG + Intergenic
924691718 1:246357855-246357877 GTGAAATTTCTGTTTTAAGGAGG - Intronic
924829765 1:247581021-247581043 GTGACATTTATGTTTTAAGGAGG - Intergenic
1063278597 10:4599061-4599083 CAGAACTTTCAGTTCTGAGGTGG - Intergenic
1063428436 10:5967208-5967230 CTTGCCTTTCTTTTTTGAGACGG + Intronic
1064225419 10:13479568-13479590 TTGACCTTCTTGTTTTGAGAAGG + Intronic
1065555698 10:26913603-26913625 CTGGCCTTTTTTTTTTGAGATGG - Intergenic
1066536310 10:36395932-36395954 CTGTCTTTTCTTTTTTGAGATGG - Intergenic
1066987318 10:42479539-42479561 CTGAGCTTTCTGCTTTTGGGAGG - Intergenic
1067086143 10:43239441-43239463 CTGACCTTTTTGTTTTTTGCTGG - Intronic
1068340434 10:55695233-55695255 GTGACTTTTTTTTTTTGAGGCGG + Intergenic
1069062533 10:63909148-63909170 CTGACCATTCTTTGTTGTGGAGG - Intergenic
1069980006 10:72245889-72245911 CCTACCTTTTTGTTTTGAGACGG - Intergenic
1070341744 10:75504380-75504402 CTGAGCTTTCAGTTGTGAGTGGG + Intronic
1071408747 10:85365611-85365633 CTATGCTTTATGTTTTGAGGGGG + Intergenic
1072108075 10:92292044-92292066 CTGACCTTACAGTTCGGAGGTGG - Intronic
1072470370 10:95707377-95707399 CTGCCCTTTCTGAATTGGGGTGG - Intergenic
1072581317 10:96742309-96742331 CTCCCCTTTCTTTTTTGAGATGG - Intergenic
1072884724 10:99263041-99263063 TTGACCTTACTGTTTTAAGCTGG + Intergenic
1073309276 10:102528143-102528165 CTGACCTTTGAGTTTGGGGGTGG + Intronic
1073951494 10:108814415-108814437 TTGACTTTTGTGTTTTGAGTTGG + Intergenic
1075640863 10:124063377-124063399 ATGACCTTTTTTTTTTGAGACGG - Intronic
1075745040 10:124721195-124721217 CTGAACTTTATTTTTTGAGATGG - Intronic
1076215773 10:128692561-128692583 CTGTCCTTTCTGATTTGATTAGG - Intergenic
1076285660 10:129293879-129293901 CTGACAGTTCTGTTTTGCGGTGG + Intergenic
1076566599 10:131403451-131403473 CAGACCCATCTGTTTTGATGCGG - Intergenic
1076663598 10:132071953-132071975 CTTTCCTTTCTTTTTTGAGATGG + Intergenic
1077286568 11:1768599-1768621 TCGACCTTTTTTTTTTGAGGTGG + Intergenic
1079816036 11:25059606-25059628 CTGATGTTTCTGCCTTGAGGGGG + Intronic
1080091268 11:28352174-28352196 CTGACCTTTCTGCCGGGAGGAGG + Intergenic
1081978502 11:47251152-47251174 CTGACTTTTTTTTTTTGAGACGG - Intronic
1083541798 11:63516413-63516435 CTGACCTTCTTGTTTTCTGGCGG - Exonic
1083586926 11:63866875-63866897 CTGACTTTTCTTTTTTTAGATGG + Intronic
1085281047 11:75331026-75331048 CTGATTTTTATTTTTTGAGGCGG + Intronic
1085659138 11:78346813-78346835 TAGACCTTTCTTTTTAGAGGGGG + Intronic
1086207643 11:84279269-84279291 ATGACCATTCTGTCTTGAGATGG - Intronic
1088114893 11:106302762-106302784 CTGACCTCCCTGCTTTGAGGTGG + Intergenic
1088220241 11:107562987-107563009 CTGACTTTCCAGTTTTGAAGTGG - Intronic
1089233485 11:117001898-117001920 CTGATTTTTCTTTTTTTAGGTGG - Intronic
1090366163 11:126207832-126207854 CTGGCCTTTTTTTTTTGAGATGG - Intronic
1090809566 11:130224677-130224699 CTGTTCTTTTTTTTTTGAGGTGG - Intergenic
1090997897 11:131883814-131883836 CTGCCCTTTCTACTTTTAGGGGG - Intronic
1091678265 12:2507313-2507335 CTCCCCTTTCTGGTTTAAGGAGG + Intronic
1093688964 12:22087859-22087881 CTTACCTTTATGTTTGAAGGAGG + Intronic
1096374064 12:51092973-51092995 GTGACTTTTTTGTTTTGAGACGG - Intergenic
1098108878 12:67100914-67100936 CTGAACTTTTTGTTTAGAAGGGG - Intergenic
1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG + Intergenic
1103334679 12:120180318-120180340 CTGGCCTTTATTTTTTGAGATGG - Intronic
1103554982 12:121760780-121760802 CTGACATTCCTGGTTGGAGGGGG + Intronic
1106148804 13:27077786-27077808 GTGACCTTAGTGTTTTGAGCAGG - Intronic
1106635007 13:31519310-31519332 TGGACCTTTCTGTTTTGTTGGGG - Intergenic
1109353510 13:61211705-61211727 ATGACCTTTCTTTTCAGAGGTGG + Intergenic
1109405364 13:61891247-61891269 CTGCTCTTTCTGTTGAGAGGTGG + Intergenic
1110171067 13:72501004-72501026 CTGACATTTTTGTTTTCAGTTGG - Intergenic
1110525249 13:76528713-76528735 CTGACCTTTCTGTGTTAAATGGG + Intergenic
1110754631 13:79158004-79158026 CTGAACTTTCTTTTTTAAGGGGG - Intergenic
1110869402 13:80432706-80432728 CTGCCCATTCTGTTTTGACTAGG + Intergenic
1111085947 13:83374838-83374860 CTGATCTTTCTGTCTTGTGAAGG + Intergenic
1111392781 13:87620229-87620251 CTGACATTTTTGTCTAGAGGAGG - Intergenic
1114065837 14:19059426-19059448 CTGCACTTTCTGTTTGGTGGTGG - Intergenic
1114096430 14:19340599-19340621 CTGCACTTTCTGTTTGGTGGTGG + Intergenic
1114709130 14:24760363-24760385 CTGGCCTTTCAGATTTGTGGTGG - Intergenic
1115915066 14:38302526-38302548 CTGACCTTTCTGATCTGTGTGGG - Intergenic
1117396869 14:55319679-55319701 CTGAACTTTCTTTTTTTAGATGG + Intronic
1117406614 14:55410534-55410556 CTTTCCTTTCTCTTTTGAGGAGG - Intronic
1118296868 14:64578019-64578041 CTGGCCTTTTTTTTTTGAGATGG + Intronic
1118936993 14:70297524-70297546 TTGACCTTACTGTTTTAAGCTGG - Intergenic
1119658100 14:76431844-76431866 CTGACCCTTGTGTTCTGGGGAGG - Intronic
1120595349 14:86427484-86427506 CTGCCTTTTTTTTTTTGAGGGGG + Intergenic
1121150385 14:91628039-91628061 CTGCCCTTTCTGGTGGGAGGGGG + Intronic
1125143050 15:36432437-36432459 CTGACCTGTTGGTTTTGAGAAGG + Intergenic
1125210029 15:37203698-37203720 CTTATTTTTCTCTTTTGAGGCGG - Intergenic
1126035407 15:44540398-44540420 CTGACCTATTTATTTTGAGACGG + Intronic
1128496026 15:68199162-68199184 CTAACCTTTTTTTTTTGAGGGGG - Intronic
1128517469 15:68351650-68351672 CTGACCTTGCTGTTTTGGACAGG + Intronic
1128790790 15:70432083-70432105 CCGCCCTTTCTGTGTTGTGGTGG - Intergenic
1129255244 15:74330597-74330619 CTGACCATGCTGATTTGAGCTGG + Intronic
1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG + Intergenic
1130623365 15:85487487-85487509 GTGATCTTTCTGTGTTGAGATGG + Intronic
1130747453 15:86671061-86671083 CTTACCTGTCTCTTTTAAGGAGG + Intronic
1130877252 15:88025386-88025408 TTGACCTAGCTTTTTTGAGGGGG - Intronic
1131934340 15:97486355-97486377 CTGACTTTTCTGTTTAAAGTGGG + Intergenic
1202953919 15_KI270727v1_random:61747-61769 CTGCACTTTCTGTTTGGTGGTGG + Intergenic
1132529801 16:440904-440926 CTGACCTTCCTGTGTTCTGGAGG - Intronic
1133174201 16:4001551-4001573 CCCACCTTTCTTTTTTGAGATGG + Intronic
1137258665 16:46801682-46801704 TTGACCTTTTTTCTTTGAGGAGG + Intronic
1137338603 16:47574981-47575003 CAGACATTTTTGTTTTGAGAGGG + Intronic
1139752149 16:69115427-69115449 CTGACAGCTCTGTTTAGAGGAGG + Exonic
1140398922 16:74653903-74653925 CTGACATTTCTTTTTTTAAGAGG - Intronic
1140895701 16:79322587-79322609 CAGACCTTTCTGTTTTCTAGAGG + Intergenic
1141026287 16:80551865-80551887 CTTACTTTTTTTTTTTGAGGAGG - Intergenic
1142442165 16:90106015-90106037 CAGTCTTTTCTGTTTAGAGGAGG + Intergenic
1142603353 17:1068301-1068323 CTGACCCTTGAGTGTTGAGGTGG + Intronic
1143383672 17:6511938-6511960 CAGACCTTTCTTTTTTGAGATGG - Intronic
1143568102 17:7737450-7737472 CTGGACTTTCTGTTTCTAGGTGG + Intronic
1143946902 17:10601219-10601241 CTCTCTTTTTTGTTTTGAGGAGG - Intergenic
1144386054 17:14750282-14750304 CTCACATTTTTTTTTTGAGGCGG - Intergenic
1144388792 17:14774390-14774412 CTGACCTTTCTGGTGTGATATGG + Intergenic
1144689622 17:17252062-17252084 CTGACTTTTTTTTTTTGAGACGG - Intronic
1144857144 17:18275656-18275678 CCGGCCTTTTTTTTTTGAGGTGG + Intronic
1148216770 17:45837615-45837637 CTGAGCTTTGTGTTTTTTGGGGG - Intergenic
1149264316 17:54910988-54911010 ATGACCTTTCTAATTTGAGGTGG + Intronic
1149773753 17:59341385-59341407 CTGGCCTTTTTTTTTTGAGACGG - Intronic
1149784143 17:59421336-59421358 CTGACCTGTTTCTTTTAAGGGGG + Intergenic
1150308232 17:64104812-64104834 CTGACCCTTTTTTTTTGAGATGG - Intronic
1150352426 17:64456034-64456056 CTTTCTTTTCTGTTTTGAGACGG - Intronic
1151240176 17:72751241-72751263 CTCACTTTTTTGTTTTGAGATGG - Intronic
1151293346 17:73165811-73165833 CTGTCCTTTCTGTCCCGAGGTGG - Intronic
1151590587 17:75041620-75041642 CTGTCCTTTTTCTTTTGAGACGG - Intronic
1151684651 17:75639551-75639573 CTGTCCTGTCTGTTGGGAGGGGG - Exonic
1153104624 18:1511973-1511995 CTGAGCTGGCTGTTTTGTGGTGG + Intergenic
1153868068 18:9291483-9291505 CTGGCCTTTTTTTTTTGAGACGG - Intergenic
1154958059 18:21278446-21278468 CTAAACTTCATGTTTTGAGGAGG - Intronic
1156031307 18:32716416-32716438 TTGACTTTTTTTTTTTGAGGTGG + Intronic
1158206343 18:54997328-54997350 CTGACCCTTCTGTTTTCAGCAGG - Intergenic
1158666566 18:59438143-59438165 CTGGCCTTTCTGTTTTTAGGGGG - Exonic
1160976479 19:1795248-1795270 CTGCCTTTTCTTTTTTGAGAGGG - Intronic
1161712401 19:5856405-5856427 CTGACCTTACTGTTTTAGGCTGG + Intergenic
1162901701 19:13799082-13799104 CTGACCTATTTTTTTTGAGATGG + Intronic
1163423917 19:17230458-17230480 CTTCCCTTGCTGTTTTCAGGAGG + Intergenic
1164153391 19:22573351-22573373 CTGTCCATTCTGTTTTAAGTTGG - Intergenic
1164220461 19:23188546-23188568 CTGTCCATTCTGTTTTAAGTTGG + Intergenic
1165189922 19:34054205-34054227 ATGACTTTTTTTTTTTGAGGCGG - Intergenic
1165351000 19:35275653-35275675 TTGACCTTTCTGTTATTTGGAGG + Intronic
1166590566 19:43994302-43994324 CTTACTTTTCTGTATTGATGTGG - Intronic
925127773 2:1473086-1473108 CTGACAGTTCTGTATTGATGGGG - Intronic
925395029 2:3527176-3527198 GTGATTTTTCTCTTTTGAGGGGG - Intergenic
925583684 2:5440917-5440939 ATGAACTTTGTGTTTTGAGAGGG + Intergenic
927488429 2:23504870-23504892 CTGAGCTTGGTGGTTTGAGGAGG - Intronic
928140346 2:28723374-28723396 CTGGCCTTTCTTTTTTTGGGGGG - Intergenic
928560466 2:32478919-32478941 CAGACCTTTATGCTTTTAGGGGG - Intronic
929154919 2:38780631-38780653 CTGACCTTTTTTTTTTGAGATGG + Intronic
930751250 2:54936568-54936590 TTAACCTTTATGTTTTGAAGAGG + Intronic
931217775 2:60262473-60262495 ATGCCCATTCTGTTATGAGGGGG - Intergenic
931948499 2:67335421-67335443 TTGACCTTCCTGTTTTAAGCTGG + Intergenic
932285450 2:70528094-70528116 CTGCCCTCTCTGTTTTCAGCAGG - Intronic
932996454 2:76860034-76860056 CAGGCCTTTCTGTATTGAGTGGG - Intronic
934520368 2:95016571-95016593 CTGCTCTTTCTGTGTTGGGGAGG - Intergenic
936112098 2:109673511-109673533 CTGACCTTTTTGATTTGGGTGGG + Intergenic
936386175 2:112031356-112031378 CATACCTTTCTATTTTGGGGTGG - Intergenic
937916141 2:127099806-127099828 CTGGCCTTTTTTTTTTGAGACGG + Intronic
938469830 2:131548320-131548342 CTGACCTTTTTGGTTTGGGTGGG + Intergenic
938483244 2:131679559-131679581 CTGCACTTTCTGTTTGGTGGTGG - Intergenic
939779398 2:146426654-146426676 GTGTACTTTCTGTTTTGGGGTGG - Intergenic
940417973 2:153443913-153443935 CTGACCTTTTTTTTTTGAAATGG - Intergenic
941392975 2:164937876-164937898 CCGTCCTTTTTTTTTTGAGGAGG + Intronic
943207419 2:184918588-184918610 CTGAATTTTCTTTTTTGGGGTGG + Intronic
944509574 2:200451393-200451415 ATGAACTTTCTGATTTGAGAGGG - Intronic
944699420 2:202233346-202233368 CTGACCTTAGTGATTTGAGTGGG + Intronic
945173724 2:207021226-207021248 TTGACCTTACTGTTTTAAGCTGG + Intergenic
945183716 2:207118178-207118200 CTGACCTTTCTTATTTGATAGGG + Intronic
945301210 2:208217961-208217983 TTGACCTTCCTGTTTTAAGCTGG - Intergenic
945440389 2:209872005-209872027 CTTCCTTTTCTTTTTTGAGGTGG + Intronic
946458613 2:219850232-219850254 CTGTCCTTTCTTGTTTGAAGGGG + Intergenic
946809734 2:223511015-223511037 CTTAGCTTCCTGTTCTGAGGAGG - Intergenic
1169281681 20:4273021-4273043 CTGTTCTTTTTCTTTTGAGGTGG + Intergenic
1169511440 20:6268399-6268421 ATATCCTTTCTGTTTTGAGATGG - Intergenic
1172164456 20:32890479-32890501 CTGACCTTCCAGTCTGGAGGAGG - Intronic
1173511590 20:43633337-43633359 TTGACCTTTTTTTTTTGAGACGG - Intronic
1173636296 20:44561330-44561352 CTGACTTTTTTTTTTTGAGACGG - Intronic
1173907753 20:46641144-46641166 CAGCCCTTTCTATTTTGAGCTGG - Intronic
1174038919 20:47685519-47685541 CTGGCCTCTTTGTTTTGAGATGG + Intronic
1176345368 21:5739254-5739276 TTGATCTTTCTGTTTTTAGATGG - Intergenic
1176352182 21:5859838-5859860 TTGATCTTTCTGTTTTTAGATGG - Intergenic
1176449265 21:6849168-6849190 CTGCACTTTCTGTTTGGTGGTGG - Intergenic
1176499459 21:7585201-7585223 TTGATCTTTCTGTTTTTAGATGG + Intergenic
1176539689 21:8137324-8137346 TTGATCTTTCTGTTTTTAGATGG - Intergenic
1176558640 21:8320369-8320391 TTGATCTTTCTGTTTTTAGATGG - Intergenic
1176827433 21:13714192-13714214 CTGCACTTTCTGTTTGGTGGTGG - Intergenic
1178366227 21:31991220-31991242 CCCACCTTTTTTTTTTGAGGTGG + Intronic
1178605549 21:34033689-34033711 CTGGCCTTTCTGTCTTCTGGCGG - Intergenic
1178837800 21:36113228-36113250 CTGACATTTCTGGTGTGTGGGGG + Intergenic
1179125604 21:38588142-38588164 CTGACTTTTTTGCTTTGATGAGG - Intronic
1180484318 22:15782018-15782040 CTGCACTTTCTGTTTGGTGGTGG - Intergenic
1180872173 22:19152436-19152458 CTAATGTTTCTGTTTTGGGGGGG + Intergenic
1181119471 22:20656306-20656328 CTGACCTTTTTGATTTGGGTGGG - Intergenic
1181924500 22:26347699-26347721 CTGACGTTTCTCTTTTAAAGAGG + Exonic
1183107684 22:35626809-35626831 CTGATTTTTTTTTTTTGAGGCGG + Intronic
1183889612 22:40915803-40915825 CTGAACTATGTGTTCTGAGGAGG + Intronic
1203244638 22_KI270733v1_random:53679-53701 TTGATCTTTCTGTTTTTAGATGG - Intergenic
950271022 3:11615201-11615223 CTGACCTGTCTCTTTTTTGGTGG + Intronic
950522490 3:13505305-13505327 CAGACCTTGCTTTATTGAGGGGG - Exonic
951316071 3:21191088-21191110 TTGACCTTGCTGTTTTAGGGTGG - Intergenic
952911296 3:38189754-38189776 CTGAGCTTACAGTTTTGTGGGGG + Intronic
955760734 3:62279072-62279094 CTGACCTCTCAGTTCTGAGATGG + Intronic
955770213 3:62378045-62378067 CTGACTTTTTTTTTTTGGGGGGG + Intergenic
955779510 3:62469515-62469537 CTGGCCTTTTTTTTTTGAGATGG + Intronic
956053857 3:65277796-65277818 CTAAGCTTTCTCTTTTGGGGAGG - Intergenic
956367457 3:68519918-68519940 ATTACCTTTCTGAATTGAGGGGG + Intronic
956792209 3:72688781-72688803 CTGACCTTTCTGATTTAGGGGGG - Intergenic
957289587 3:78261684-78261706 CTGACTTTTTTCTTTTGATGAGG - Intergenic
957904584 3:86540108-86540130 TTGACCTTACTGTTTTGGGCTGG - Intergenic
958809371 3:98842058-98842080 CTGTGCTTTCTTTTTTGAGATGG - Intronic
960532692 3:118782743-118782765 CTTTCCTTTATGATTTGAGGTGG - Intergenic
961538118 3:127582263-127582285 CTGTCCTTACTGTTTAGATGGGG - Intronic
962556151 3:136553766-136553788 TTGAACTTTTTGTTTTGAGATGG - Intronic
962818383 3:139022418-139022440 CTGAGCTTTTTTTTTTGAGACGG + Intronic
964178739 3:153857584-153857606 CTTTCCTTTCTTTTTTGAGATGG - Intergenic
965883218 3:173412501-173412523 CTGACCTTTTTTTTTTAATGAGG + Intronic
966189134 3:177255927-177255949 CTTATCTTTATTTTTTGAGGCGG + Intergenic
966710124 3:182963323-182963345 CTGCCCTTTCTGTTTTTTAGTGG - Intronic
967880036 3:194295327-194295349 CTGACCTTTCATTTTTGTCGAGG + Intergenic
968061225 3:195727365-195727387 CTTACCTTTTTTTTTTGAGACGG - Intronic
968179311 3:196579993-196580015 CTGACTTTTTTTTTTTGAGACGG + Intronic
968362434 3:198156976-198156998 CGGTCTTTTCTGTTTAGAGGAGG + Intergenic
968637075 4:1685928-1685950 CTGACGTTTGTGATTTGAAGTGG - Intergenic
971222651 4:24722781-24722803 GTGAACTTTTTTTTTTGAGGTGG - Intergenic
977120438 4:93093194-93093216 CTGACATTCCTATCTTGAGGAGG - Intronic
977413180 4:96694386-96694408 CTGACATATCTGTTTTCAAGAGG - Intergenic
977798456 4:101196709-101196731 CTGATCTTTCACTTTTAAGGAGG - Intronic
978609933 4:110526296-110526318 CTGTAATTTCTGTTTTGGGGCGG - Intronic
978907454 4:114024438-114024460 CTGATCTGTTTATTTTGAGGTGG + Intergenic
979782833 4:124676843-124676865 CTGACCTTTATGTTTTTATTGGG - Intronic
982070353 4:151688797-151688819 CTGATCTTTCATTTTTGGGGAGG - Intronic
983996701 4:174190843-174190865 CTGATATTCCTGTTTTGTGGTGG - Intergenic
986362011 5:6987913-6987935 CAGACCTTTCTGTTCAGAAGTGG - Intergenic
986397041 5:7341421-7341443 ATGGCCATTCTGTTTTGAGCAGG - Intergenic
986667046 5:10113355-10113377 CTGACCTTTCAGGTTTCAAGTGG + Intergenic
987993677 5:25247881-25247903 CTGGCATTTTTGTTTTGAGCGGG - Intergenic
988359249 5:30213514-30213536 CTGTCCTTTTTGTTTTTTGGTGG + Intergenic
988650034 5:33138824-33138846 TTGAACTTTCTGTGTCGAGGAGG + Intergenic
992321350 5:75616059-75616081 CGGTCCTTTCTGTTTGGAGATGG + Intronic
992785114 5:80162841-80162863 CTGACTTTTTTTTTTTGAGGCGG + Intronic
993437011 5:87909888-87909910 CTGACCATTCTGCTTTAAAGAGG - Intergenic
993534929 5:89071510-89071532 CTGACTTTTCTTTTCTGAGAGGG - Intergenic
993805960 5:92409660-92409682 CTCAGCTTTCTGTTTTGGAGGGG + Intergenic
994936435 5:106259154-106259176 CTGACAGTTCTCTTTTGAAGGGG + Intergenic
995332790 5:110964401-110964423 ATTTCCTTTCTGTTTTGATGAGG - Intergenic
996189801 5:120526057-120526079 CTAGTCTTTCTGTTCTGAGGTGG + Intronic
996723081 5:126648687-126648709 TTGACCTTTCTGTTTTAGGCCGG + Intergenic
997528447 5:134568093-134568115 CTGACCTCTCTGTTCTGTGCTGG + Intronic
998053081 5:139052677-139052699 CTGAACTTTTTTTTTTGAGACGG - Intronic
998823946 5:146082412-146082434 CTCAGTTTTCTTTTTTGAGGTGG + Intergenic
999000205 5:147912536-147912558 CTGACCTACCTTTGTTGAGGAGG + Intergenic
999305941 5:150519679-150519701 CTTACTTTTTTTTTTTGAGGCGG - Intronic
1001195484 5:169669694-169669716 CTGTCCTTTCTGTGTTGACCTGG - Intronic
1004923043 6:20394909-20394931 ATGTCCTTTCTGTTTTCATGTGG - Intergenic
1004941048 6:20556359-20556381 CTTACTTTTTTTTTTTGAGGCGG - Intronic
1005161784 6:22872374-22872396 CTGACATTTCTAATGTGAGGTGG - Intergenic
1006765041 6:36497535-36497557 GTGAACTTTGTTTTTTGAGGTGG - Intronic
1011612435 6:89166658-89166680 CTGAGGTTTCTCTTTTAAGGTGG - Intergenic
1011638290 6:89395901-89395923 CTGTCCTTTCTTCTTGGAGGTGG - Intronic
1012011889 6:93798931-93798953 CTGATCTTTCTGTATAAAGGAGG + Intergenic
1013562547 6:111320070-111320092 CTGGCCTTTTTTTTTTGAGATGG + Intronic
1013838748 6:114364231-114364253 CTGACTTTTCTCTTTTGAAGGGG - Intergenic
1014174906 6:118321662-118321684 CTGACATTTGTGTGTTGAGTAGG - Intergenic
1016204772 6:141456632-141456654 TTGACCTTACTGTTTTAAGCTGG + Intergenic
1017281936 6:152635770-152635792 CTGAGCTTTTCGTTTTGGGGTGG - Intronic
1017906794 6:158761990-158762012 CTGAGCTCTCGGTTTTGGGGTGG + Intronic
1018110193 6:160529518-160529540 CTGACGATTATGTCTTGAGGTGG - Intergenic
1018675927 6:166222440-166222462 AGGACCTGCCTGTTTTGAGGGGG + Intergenic
1019253246 7:31731-31753 CGGTCTTTTCTGTTTAGAGGAGG - Intergenic
1020038777 7:4985471-4985493 CTGCCCATTCTCTTCTGAGGGGG - Intronic
1020940258 7:14524588-14524610 CTGACTTTTCTATTTTTAGTAGG - Intronic
1023010858 7:35923820-35923842 CTGACTTTTTTTTTTTGAGATGG - Intergenic
1025202999 7:56973612-56973634 CTGATTTTTTTTTTTTGAGGAGG + Intergenic
1025668945 7:63603314-63603336 CTGATTTTTTTTTTTTGAGGAGG - Intergenic
1027430137 7:78103559-78103581 TTGACCTTTCTTTTGTGATGAGG + Intronic
1028041214 7:86057626-86057648 CTGAGATTCCTGTTTTGTGGGGG + Intergenic
1029895989 7:103985483-103985505 CTGACCTCTCCTTTTTGATGGGG + Intronic
1033146175 7:138871883-138871905 CTGACTTTTCAGTTCTGATGTGG + Intronic
1033245134 7:139711421-139711443 CTAACCTTTTTTTTTTGAGACGG - Intronic
1034495791 7:151421395-151421417 CTGACTTTTTTTTTTTGGGGGGG - Intergenic
1034868879 7:154665087-154665109 ATGACCTTGCACTTTTGAGGAGG + Intronic
1036391252 8:8326043-8326065 CTGACCTTTCTGTTTTGAGGAGG - Intronic
1036452277 8:8879345-8879367 CTTACCTTTTTTTTTTGAGATGG - Intronic
1037422943 8:18723559-18723581 GTTCCCTTTCTATTTTGAGGTGG + Intronic
1039449441 8:37659864-37659886 CTTTCCTTTTTTTTTTGAGGTGG - Intergenic
1042567742 8:70129673-70129695 CTGACTTTTTTTTTTTGAGACGG + Intronic
1042793281 8:72632595-72632617 CTGACCTTTGTGCTGTGAGGGGG + Intronic
1042919448 8:73907592-73907614 CTGACCTTCCTCTTTGTAGGAGG + Intergenic
1048113162 8:131489822-131489844 CTGACTTTTCTATTTTGATGTGG - Intergenic
1048135703 8:131744540-131744562 TTGACCTTACTGTTTTAAGCTGG + Intergenic
1048380845 8:133863525-133863547 CTGTGCTTTCTGATTTGTGGAGG + Intergenic
1049868556 8:144955989-144956011 TTGACCTTACTGTTTTAAGCTGG - Intergenic
1051775262 9:20625002-20625024 CTGATCTTTTTGTTGTGAAGGGG - Intergenic
1052041694 9:23746512-23746534 CTCACCTCTCTGTTCTGAGGTGG - Intronic
1053093567 9:35303457-35303479 CAGTCCTTTCTGTTTTGAATGGG + Intronic
1056634385 9:88319697-88319719 CTGACCTTTTTTTTTTCTGGAGG + Intergenic
1057209476 9:93192017-93192039 CTGGCCTTTTTTTTTTGAGACGG - Intronic
1057256536 9:93553209-93553231 CTGACCCCTGTGTTTTGAGGAGG + Intronic
1057378876 9:94551000-94551022 CTGACCTTTTTGGTTTGAGTGGG - Intergenic
1057498415 9:95578102-95578124 CTGACCTATGTGTTTAGTGGCGG + Intergenic
1058132237 9:101265989-101266011 GTGACCTTTTTTTTTTGAGGCGG - Intronic
1058524739 9:105845542-105845564 CTGACCAGGCTGTTTTGGGGGGG + Intergenic
1059138898 9:111833603-111833625 CTGACCTTACTGTGCTCAGGTGG - Intergenic
1060394445 9:123305589-123305611 CTTTCCTTTCTTTTTTGAGACGG + Intergenic
1060737627 9:126076518-126076540 TTGACCTTACTGTTTTAAGCTGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061810261 9:133158281-133158303 CTTTCTTTTCTTTTTTGAGGTGG + Intronic
1062747123 9:138220637-138220659 CGGTCTTTTCTGTTTAGAGGAGG + Intergenic
1203519923 Un_GL000213v1:35348-35370 CTGCACTTTCTGTTTGGTGGTGG + Intergenic
1203460972 Un_GL000220v1:36762-36784 TTGATCTTTCTGTTTTTAGATGG - Intergenic
1185624319 X:1471946-1471968 CTCTCCTTTCTGTTTTCTGGGGG + Intronic
1185638368 X:1571712-1571734 CTGGCCTTTTTTTTTTGAGATGG + Intergenic
1186776688 X:12871986-12872008 CTCACCTTTCTGTATTGAATCGG - Intronic
1187209536 X:17215451-17215473 CTGGGCTCTCTGTTTTGAGTAGG - Intergenic
1187670203 X:21658785-21658807 CTCAACTTTCTGCTTTGAAGAGG + Intergenic
1187961928 X:24574692-24574714 CTGGCATTTATGTTTTGGGGAGG - Intronic
1188600287 X:31955170-31955192 ATGAACTTTCTTTTTTGAGATGG - Intronic
1188701540 X:33270527-33270549 CTTAACTCTCTGTTGTGAGGGGG - Intronic
1194380140 X:93181214-93181236 CTGCCCCTTCTGAGTTGAGGTGG + Intergenic
1194555838 X:95357892-95357914 CTGACCTTACATTTTTGAGAGGG - Intergenic
1194638777 X:96377225-96377247 CTGACCTTTTTTTTTGGCGGGGG + Intergenic
1194775120 X:97953871-97953893 CCTACCTTTCTTTTTTGAGCAGG - Intergenic
1195045857 X:101054131-101054153 CTTACTTTTTTTTTTTGAGGTGG + Intergenic
1196845999 X:119897162-119897184 CTTTCTTTTCTTTTTTGAGGTGG + Intronic
1197389063 X:125838787-125838809 CTGACCTTTAATCTTTGAGGAGG - Intergenic
1197702116 X:129607348-129607370 CTTAACTATCTGTTTTCAGGTGG + Intergenic
1198030095 X:132746490-132746512 CTTACCTTTTTTTTTTGAGACGG - Intronic
1198703383 X:139420807-139420829 CTGAAGTTTGTGTTCTGAGGTGG - Intergenic
1200814050 Y:7513350-7513372 CTGACTTTTTTTTTTTGAGATGG - Intergenic
1201613245 Y:15866446-15866468 GTGATGTTCCTGTTTTGAGGAGG - Intergenic
1201625005 Y:16005135-16005157 TTCAGCTTTCTGTTTTGAGGGGG + Intergenic