ID: 1036391277

View in Genome Browser
Species Human (GRCh38)
Location 8:8326467-8326489
Sequence CCACATTTATAGAAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036391267_1036391277 0 Left 1036391267 8:8326444-8326466 CCCTCCTGACTCCCAATAAAAGC 0: 1
1: 0
2: 1
3: 19
4: 199
Right 1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG No data
1036391269_1036391277 -4 Left 1036391269 8:8326448-8326470 CCTGACTCCCAATAAAAGCCCAC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG No data
1036391268_1036391277 -1 Left 1036391268 8:8326445-8326467 CCTCCTGACTCCCAATAAAAGCC 0: 1
1: 0
2: 1
3: 19
4: 201
Right 1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036391277 Original CRISPR CCACATTTATAGAAGGGCCA GGG Intronic
No off target data available for this crispr