ID: 1036395861

View in Genome Browser
Species Human (GRCh38)
Location 8:8370824-8370846
Sequence CTACTGAGAAGCAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036395858_1036395861 3 Left 1036395858 8:8370798-8370820 CCACTCATGACACTGTCACTACC 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1036395861 8:8370824-8370846 CTACTGAGAAGCAGCTCAGGAGG No data
1036395857_1036395861 28 Left 1036395857 8:8370773-8370795 CCACTTCTGTGGACAGAAACGAA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1036395861 8:8370824-8370846 CTACTGAGAAGCAGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036395861 Original CRISPR CTACTGAGAAGCAGCTCAGG AGG Intronic
No off target data available for this crispr