ID: 1036397416

View in Genome Browser
Species Human (GRCh38)
Location 8:8381169-8381191
Sequence TGTGATTTGCAGACTGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036397416_1036397424 -1 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397424 8:8381191-8381213 AGGAGGAAATTCTGGGGGACTGG No data
1036397416_1036397423 -6 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397423 8:8381186-8381208 ATCACAGGAGGAAATTCTGGGGG No data
1036397416_1036397422 -7 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397422 8:8381185-8381207 AATCACAGGAGGAAATTCTGGGG No data
1036397416_1036397421 -8 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397421 8:8381184-8381206 AAATCACAGGAGGAAATTCTGGG No data
1036397416_1036397420 -9 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397420 8:8381183-8381205 CAAATCACAGGAGGAAATTCTGG No data
1036397416_1036397425 22 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397425 8:8381214-8381236 ATTAATGATTCTTAGCCTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 173
1036397416_1036397426 23 Left 1036397416 8:8381169-8381191 CCCTACACAGTCTGCAAATCACA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1036397426 8:8381215-8381237 TTAATGATTCTTAGCCTAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036397416 Original CRISPR TGTGATTTGCAGACTGTGTA GGG (reversed) Intronic
900863219 1:5247718-5247740 TATGATTTGCAGGCTGGGTGTGG + Intergenic
903454883 1:23480620-23480642 TTTGATTTGCTGACTGACTAGGG - Intronic
903965525 1:27086769-27086791 TGTGGTGTGCAGGGTGTGTATGG - Intergenic
908973873 1:69872983-69873005 TGTCATTTTCAGAGAGTGTAGGG + Intronic
910052452 1:82991523-82991545 TGTGCTTAGCATACTGTGTGGGG + Intergenic
912895043 1:113577393-113577415 GGAGAATTGGAGACTGTGTATGG + Intronic
912913505 1:113787835-113787857 TGTCATTTGAAGACTGGATAGGG - Intronic
915315291 1:155025198-155025220 TGTGAGCTCCAGACTGTGTCTGG + Intronic
915578871 1:156801343-156801365 TATGATTTGCACACTGTTTTTGG - Intergenic
919114656 1:193265674-193265696 TGTGATTTGTAGACTGTAAGAGG - Intergenic
919533878 1:198761945-198761967 TGTCATTTGTACACTGTTTAAGG - Intergenic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
1063252153 10:4285468-4285490 TGTGATTTGCACACACTATAAGG + Intergenic
1064633479 10:17340903-17340925 TGGGATATGAAGACTGTGTGTGG - Intronic
1066454228 10:35559345-35559367 TGTGACTTCCACACTGTGCATGG - Intronic
1066505087 10:36033587-36033609 TGTGATATGTAAACTGTGTTGGG + Intergenic
1068253626 10:54477503-54477525 TGTGTTTTGCACACAGAGTATGG + Intronic
1069240478 10:66131876-66131898 TGATATTTGTATACTGTGTAAGG - Intronic
1069387932 10:67901519-67901541 TATGCTTTGCAGACTGCATAGGG + Intronic
1069745435 10:70712123-70712145 TGTGATTTGCAGAGTCTGGGTGG - Intronic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1073934394 10:108613512-108613534 TGTGATTTTCAGGCTGGGCATGG - Intergenic
1076001619 10:126917533-126917555 TGGGAATTGCAGACTGTGACCGG - Intronic
1076012159 10:126998082-126998104 TCTGCTTTTGAGACTGTGTATGG - Exonic
1076628996 10:131841616-131841638 TGTGCTGTGCAGGCTGTGTCGGG - Intergenic
1079458112 11:20654330-20654352 TGTGTTTTGCAGACTGTGTTTGG + Intronic
1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG + Intronic
1087951632 11:104227892-104227914 GATGATTTGCAGATTCTGTAGGG - Intergenic
1091890519 12:4050295-4050317 TGTGAATTGCAGATTGTGGGAGG - Intergenic
1093920646 12:24855960-24855982 TCTGATTTGCACATTGTTTAAGG - Intronic
1094801443 12:34040650-34040672 TGTTAATTGCACACAGTGTAAGG + Intergenic
1095580008 12:43786964-43786986 TGTAATTTTCAAACTGTGTTTGG - Exonic
1098227105 12:68335489-68335511 TGTGATTTGCACAGTCTGAAGGG + Intergenic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1100470592 12:94889308-94889330 TGAGATTTGGAGACAGTGTGGGG + Intergenic
1101802893 12:108037888-108037910 TGTGGGGTGCAGACTGGGTAGGG - Intergenic
1103950556 12:124548774-124548796 GGTCATTTGAAAACTGTGTAGGG - Intronic
1104262071 12:127193771-127193793 AGTGCTTTGCAGACTCTGAAGGG + Intergenic
1105614775 13:22001721-22001743 TGTCATTTGCAGACTCTGACTGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108371201 13:49770690-49770712 TGGTTTTTGCATACTGTGTAAGG + Intronic
1109307395 13:60655877-60655899 TGTAATTTGGGGGCTGTGTATGG + Intergenic
1110379558 13:74834835-74834857 TGTCATTTGCATACTGTTTATGG + Intergenic
1111184258 13:84710977-84710999 TGTGGTTTCCAGACTGTCTCTGG + Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1115809117 14:37086289-37086311 TGTGATTGTCATACTGTGGAGGG - Intronic
1117300605 14:54422380-54422402 TGTGATTTTTAAATTGTGTATGG - Intergenic
1117628009 14:57660194-57660216 TGTGATTTGCAAAGTGTTTTTGG + Intronic
1117959145 14:61146092-61146114 TGTGATTTCCAGACTGCCTGGGG - Intergenic
1118189867 14:63570637-63570659 TGTGGTTAGGAGACTGTGTTGGG + Intergenic
1121160331 14:91732903-91732925 TGTGTTTTGCACACTGTTTCAGG - Intronic
1121893468 14:97621595-97621617 TCTGATTTGCAGAATTTTTATGG + Intergenic
1122697576 14:103563568-103563590 TGTTATTTGCAAACTATGTGTGG + Intronic
1124208158 15:27740822-27740844 TCAGATCTGCTGACTGTGTAGGG - Intergenic
1124965196 15:34428382-34428404 TGTGATTTGAAGGCTGGGCACGG - Intronic
1125067940 15:35514085-35514107 TGTGATTTGCATACATAGTAGGG + Intronic
1128131624 15:65231431-65231453 TATAATTTGCAAACTATGTAAGG - Intergenic
1128271053 15:66310153-66310175 TTTGAATTGCAGATTCTGTAAGG + Intronic
1135349073 16:21713599-21713621 TGTGAGGTACAGAGTGTGTAAGG + Intronic
1135686187 16:24500089-24500111 AGTGATTTGCAGAGCTTGTAGGG + Intergenic
1135988844 16:27204629-27204651 TGTGATTTGCAGAGGGTCTCAGG - Intronic
1138238210 16:55403577-55403599 TTTGAATTACAGACTGTGTAAGG - Intronic
1141433038 16:83980757-83980779 TGTGTTTCGCAGGCTGTGCAGGG + Intronic
1141819186 16:86433271-86433293 GGTGCTTTGCAGAATGTGTTTGG - Intergenic
1146604936 17:34250034-34250056 GATGATTGTCAGACTGTGTATGG - Intergenic
1147041299 17:37721437-37721459 TATTATTTGAAGACTGTGTGTGG - Intronic
1151125084 17:71836062-71836084 TGTGTTTTGCATATTGTCTATGG - Intergenic
1153466597 18:5395137-5395159 CGTGTCTTGCAGACTGTGAAAGG - Exonic
1154247431 18:12711646-12711668 TGTTATTTGCAATCTGTTTATGG + Intronic
1155658373 18:28218574-28218596 TGAGATTTTCAGAATATGTAAGG - Intergenic
1155934323 18:31739499-31739521 GGTGATTTGGTGATTGTGTAGGG - Intergenic
1156740388 18:40319730-40319752 TGTGTTTTGTAGACAGTGTAAGG - Intergenic
1157132796 18:45023038-45023060 TGTGATTTGAACACTGAGAATGG + Intronic
1157966591 18:52215827-52215849 TTTAATTTCCAGCCTGTGTAGGG + Intergenic
1159013961 18:63086530-63086552 TGTGATTTTAGGACTGTGTACGG + Intergenic
1159529209 18:69634552-69634574 TGTGAATTGAATACTGTGTAAGG + Intronic
1163405892 19:17122030-17122052 TGTGGTTTGGAGATTGTGTGGGG + Intronic
1165315545 19:35053272-35053294 TGTGATTTCCAGAAAGTGTGAGG - Intronic
1165920007 19:39291107-39291129 TGTGATTTGTTCACTGTGTAAGG - Intergenic
1166991754 19:46697052-46697074 TGTGATTTGCAGGATCTGTCTGG + Intronic
925378385 2:3405352-3405374 TGGGCTGTGCGGACTGTGTAAGG - Intronic
925573206 2:5333219-5333241 AGTGTTTTGCAAACTGTGTAAGG + Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926559786 2:14403304-14403326 TGGGATTTGCCAATTGTGTAAGG - Intergenic
926898384 2:17721085-17721107 TGTGATATGCAGAATGTATTTGG - Intronic
927960946 2:27240378-27240400 TGTGACTCAGAGACTGTGTAGGG + Intronic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
929827876 2:45323756-45323778 TGGTATTTGAAGATTGTGTATGG + Intergenic
933739915 2:85525296-85525318 TGTAATTTGCCTACTGTGGAGGG + Intergenic
934734037 2:96678885-96678907 TGTGATTTGCAAATTGTCTGTGG + Intergenic
940001904 2:148975094-148975116 TGTGCTTTGAAGATTCTGTAAGG + Intronic
940589602 2:155704611-155704633 TGTGATTAGAAAACTATGTATGG - Intergenic
940702167 2:157058943-157058965 TGTGATTTGACGGCTGTGTTGGG + Intergenic
942156634 2:173135547-173135569 TGTGATTTTCAAACTGTGATGGG + Intronic
943789735 2:191918595-191918617 TGTGCTTTGCCAACTGTGTTTGG - Intergenic
944693811 2:202183043-202183065 GGTGCTCTGCAGACTGTGTTGGG - Intronic
944735965 2:202565109-202565131 TCTGATTTGTAGTCTGTGTCAGG + Exonic
947147962 2:227085929-227085951 TGTGTTTTGCACACTGTATAAGG - Intronic
948512678 2:238480760-238480782 GGTGATTTTCAGTCTTTGTAAGG + Intergenic
948798413 2:240418923-240418945 TGTGCTTTGCAGAGTGTGGGCGG + Intergenic
1168926651 20:1587291-1587313 TGTCATTTGAATACAGTGTATGG + Intronic
1170371426 20:15653099-15653121 TAGGATTTGAAGAGTGTGTAGGG - Intronic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1172208896 20:33183796-33183818 TGTGATTGGCAGAATGAGTTAGG - Intergenic
1175793208 20:61755471-61755493 TGTGATGTGCACTGTGTGTATGG - Intronic
1177267856 21:18807855-18807877 TGTGAATGCCAGATTGTGTATGG + Intergenic
1177776617 21:25574975-25574997 TTTGATTTGCAGAATATTTAAGG + Intergenic
1179016652 21:37599864-37599886 TGTGAATTTTTGACTGTGTAGGG + Intergenic
1182578390 22:31289430-31289452 TGTCATTTGCTGATTGTCTAGGG - Intronic
1183027126 22:35073671-35073693 TGTAATCTGAAGACTGAGTAGGG + Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184679909 22:46065100-46065122 TGTTTCTTGCAGACTGTGTTCGG + Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
961757227 3:129135876-129135898 TGTAAATTGCAGAATATGTATGG + Intronic
963242785 3:143026070-143026092 TGTTATTTGCCAGCTGTGTATGG + Intronic
963924837 3:150940290-150940312 TGTGATTAGCAGAATGTGGATGG + Intronic
965887299 3:173462593-173462615 TGTGAATTGGAGACTGGCTATGG - Intronic
966516318 3:180824514-180824536 TGCCATTTACAGACTTTGTATGG + Intronic
967164104 3:186765313-186765335 TATTATTTGTAGACTTTGTATGG - Intergenic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
969837859 4:9858012-9858034 TCTGATTTGCTGACTCTGAAGGG - Intronic
972281652 4:37607462-37607484 TGTGCTTTGCAGATATTGTAGGG + Intronic
973912580 4:55596664-55596686 TTGAATTTGCAGACTGTGTTTGG - Intronic
976580697 4:86732388-86732410 TGTGATTTGCAGAATTTCTTTGG + Exonic
977706902 4:100081624-100081646 TGAGACTTGAAGGCTGTGTATGG + Intergenic
978453448 4:108861888-108861910 TGTTATTGGCATACTGTGGATGG - Intronic
979568270 4:122182399-122182421 GATGATTTGGAAACTGTGTATGG - Intronic
980975329 4:139605406-139605428 TGAGATTTGAAGCCTGAGTAAGG + Intronic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984743769 4:183193613-183193635 TGTCATTTGCTGATTGTGTTGGG + Exonic
987445522 5:18013716-18013738 TGTGATTTGCTGATATTGTATGG + Intergenic
987568541 5:19625405-19625427 TATGATTTGCAGATTGTTTTAGG - Intronic
990731664 5:58815489-58815511 TGTCCTTTGCAGACTGTGATGGG + Intronic
990887650 5:60613113-60613135 TTTGTTATGCAGACTTTGTAAGG - Intronic
992264767 5:75007703-75007725 TGTCATCTTCAGACTGTGCAGGG - Intergenic
995002322 5:107148959-107148981 TGTGTATTGCAGCCTGTGTGTGG + Intergenic
995530810 5:113090231-113090253 CGTGATTTGCAGACTGTCAGGGG + Intronic
995670107 5:114593651-114593673 TGTGATTTGCAGATACTGTGGGG - Intergenic
995857003 5:116603895-116603917 TGTGGATTGCATACTGTGCATGG + Intergenic
995963682 5:117877168-117877190 TGTGATTCACAGGCTGTGTTGGG + Intergenic
996396642 5:123020567-123020589 TGTGAATTGCAGAATATTTATGG - Intronic
999466166 5:151807514-151807536 TTTGATTTGCAGATTATATATGG + Exonic
999622656 5:153488520-153488542 TTTGTTTTGCATACTTTGTAGGG - Intergenic
999871299 5:155754038-155754060 TTGAGTTTGCAGACTGTGTATGG + Intergenic
999933433 5:156458471-156458493 TGTCATTTGCTGACTGTGTTGGG - Intronic
1001726102 5:173901972-173901994 AGGGATTTGCTGCCTGTGTAGGG + Intronic
1009878470 6:69535678-69535700 TGTGATTTGAAGACTTTTTAAGG - Intergenic
1011321499 6:86098621-86098643 TGTGATTCCCAGAGTGTGAATGG - Intergenic
1014369450 6:120586176-120586198 TATGATTTACAGAATGTGTTAGG - Intergenic
1016259382 6:142149341-142149363 TGTAATGTGCAGACAGTTTAAGG + Intronic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1020927303 7:14347213-14347235 TGTGGTTTTGAGACAGTGTAGGG - Intronic
1021405851 7:20266433-20266455 TGTTATTTCCAGACTTTTTAAGG + Intergenic
1021790922 7:24204734-24204756 TGTGATTAATAGACTGTGAAGGG + Intergenic
1024459505 7:49645491-49645513 AGTGCTTTGCAGACACTGTAGGG - Intergenic
1025229289 7:57189812-57189834 TGTTATATACAGGCTGTGTATGG - Intergenic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1030410133 7:109166150-109166172 TGTGTTTTGCTGACTATGTTTGG + Intergenic
1030836359 7:114291747-114291769 TGCTATTTGTAAACTGTGTATGG - Intronic
1031912741 7:127534647-127534669 TGTGATTTGACCTCTGTGTATGG - Intergenic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1037101605 8:15054027-15054049 TGTGATGTGCAGACAGTAAAGGG + Intronic
1042054270 8:64747372-64747394 TGTGAATTTCTGACTGTGCAGGG - Intronic
1042648035 8:71009036-71009058 TGTTATTTGGAGACAGAGTAAGG + Intergenic
1044714664 8:95089361-95089383 TGTGACTTGGAGGCTGGGTACGG - Intronic
1046024435 8:108705179-108705201 TGTGATTAGCAGACTCTATAGGG + Intronic
1046378754 8:113424052-113424074 TGTGACTTACAGAATGTGAAAGG + Intronic
1046667821 8:117024198-117024220 TGTTTTTTGCAGACTGTGGGAGG - Intronic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1048159501 8:132001281-132001303 TTTGATTTGTAAACTGTGTGTGG + Intronic
1048880742 8:138870561-138870583 TGTGGTGTGCAGACTGTAAATGG + Intronic
1050759235 9:9045834-9045856 TGAGATATGCAGACTTTTTAGGG + Intronic
1055592176 9:77828486-77828508 TGTGCTGTGAAGACTGTGAATGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059029067 9:110669759-110669781 TGTGATTTGCAAAGTGACTAAGG + Intronic
1059170082 9:112116597-112116619 TGTTATCTGCTGACTATGTAGGG + Intronic
1059527803 9:115008309-115008331 TGTTATTTGCAGACAATGTTGGG + Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1062044107 9:134417327-134417349 GGTGAGTTGCAGCCTGTGCAGGG + Exonic
1062223457 9:135434006-135434028 TGTGATTTGAAAACAGAGTATGG + Intergenic
1186554391 X:10542196-10542218 TGTGTTTCGCAGACTTTTTAAGG + Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1192062794 X:67846822-67846844 TTTGATTTGAAGTTTGTGTATGG - Intergenic
1193503688 X:82311903-82311925 TGTTTTTTGTAGACTCTGTACGG + Intergenic
1193857355 X:86620691-86620713 TGTGATTGAGAGACTGTGGAAGG + Intronic
1201676341 Y:16589066-16589088 TGGGAATTCCAGACTGTGAAGGG - Intergenic