ID: 1036397882

View in Genome Browser
Species Human (GRCh38)
Location 8:8384305-8384327
Sequence CTGTGCAAAGGGAGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036397872_1036397882 12 Left 1036397872 8:8384270-8384292 CCTACTTTCTAAGATTCCCCAAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data
1036397876_1036397882 -10 Left 1036397876 8:8384292-8384314 CCTTTGCACAGCCCTGTGCAAAG 0: 1
1: 0
2: 2
3: 20
4: 206
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data
1036397871_1036397882 13 Left 1036397871 8:8384269-8384291 CCCTACTTTCTAAGATTCCCCAA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data
1036397874_1036397882 -5 Left 1036397874 8:8384287-8384309 CCCAACCTTTGCACAGCCCTGTG 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data
1036397875_1036397882 -6 Left 1036397875 8:8384288-8384310 CCAACCTTTGCACAGCCCTGTGC 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data
1036397873_1036397882 -4 Left 1036397873 8:8384286-8384308 CCCCAACCTTTGCACAGCCCTGT 0: 1
1: 0
2: 4
3: 19
4: 268
Right 1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036397882 Original CRISPR CTGTGCAAAGGGAGTGTGGA AGG Intronic
No off target data available for this crispr