ID: 1036398021

View in Genome Browser
Species Human (GRCh38)
Location 8:8385511-8385533
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036398014_1036398021 23 Left 1036398014 8:8385465-8385487 CCTAGGGCTTTCTGTCAAATTTT 0: 1
1: 0
2: 1
3: 14
4: 251
Right 1036398021 8:8385511-8385533 GGAGTTGTTAAGAATAGTTCAGG No data
1036398013_1036398021 24 Left 1036398013 8:8385464-8385486 CCCTAGGGCTTTCTGTCAAATTT 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1036398021 8:8385511-8385533 GGAGTTGTTAAGAATAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr