ID: 1036398210

View in Genome Browser
Species Human (GRCh38)
Location 8:8386417-8386439
Sequence AGAAGCCACCCGCCCGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036398210_1036398216 -4 Left 1036398210 8:8386417-8386439 CCGGCCGCGGGCGGGTGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1036398216 8:8386436-8386458 TTCTGCCTGGGCCCGGCGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 220
1036398210_1036398218 0 Left 1036398210 8:8386417-8386439 CCGGCCGCGGGCGGGTGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1036398218 8:8386440-8386462 GCCTGGGCCCGGCGGCCGGGTGG 0: 1
1: 1
2: 2
3: 77
4: 553
1036398210_1036398217 -3 Left 1036398210 8:8386417-8386439 CCGGCCGCGGGCGGGTGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1036398217 8:8386437-8386459 TCTGCCTGGGCCCGGCGGCCGGG 0: 1
1: 0
2: 1
3: 23
4: 291
1036398210_1036398215 -8 Left 1036398210 8:8386417-8386439 CCGGCCGCGGGCGGGTGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1036398215 8:8386432-8386454 TGGCTTCTGCCTGGGCCCGGCGG 0: 1
1: 0
2: 6
3: 68
4: 707
1036398210_1036398223 15 Left 1036398210 8:8386417-8386439 CCGGCCGCGGGCGGGTGGCTTCT 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1036398223 8:8386455-8386477 CCGGGTGGCAGCTGTGAGCGCGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036398210 Original CRISPR AGAAGCCACCCGCCCGCGGC CGG (reversed) Exonic