ID: 1036404203

View in Genome Browser
Species Human (GRCh38)
Location 8:8440670-8440692
Sequence TAGAAAAGGCTGCCTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036404199_1036404203 3 Left 1036404199 8:8440644-8440666 CCTTTCACGCCTGCATACATATA No data
Right 1036404203 8:8440670-8440692 TAGAAAAGGCTGCCTAAGACTGG No data
1036404201_1036404203 -6 Left 1036404201 8:8440653-8440675 CCTGCATACATATAGGCTAGAAA No data
Right 1036404203 8:8440670-8440692 TAGAAAAGGCTGCCTAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036404203 Original CRISPR TAGAAAAGGCTGCCTAAGAC TGG Intergenic
No off target data available for this crispr