ID: 1036405396

View in Genome Browser
Species Human (GRCh38)
Location 8:8450388-8450410
Sequence GAGAGGCCAAGGCGGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036405389_1036405396 14 Left 1036405389 8:8450351-8450373 CCAGCACAATGGCTCACACCTGT No data
Right 1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG No data
1036405390_1036405396 -4 Left 1036405390 8:8450369-8450391 CCTGTAATCTCAGCACTTTGAGA 0: 779
1: 28912
2: 320992
3: 255107
4: 138882
Right 1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG No data
1036405388_1036405396 15 Left 1036405388 8:8450350-8450372 CCCAGCACAATGGCTCACACCTG 0: 17
1: 667
2: 8640
3: 32587
4: 81235
Right 1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036405396 Original CRISPR GAGAGGCCAAGGCGGGCGGA TGG Intergenic
No off target data available for this crispr