ID: 1036407730

View in Genome Browser
Species Human (GRCh38)
Location 8:8470001-8470023
Sequence CAGGAGGATTGCTTAAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88694
Summary {0: 8, 1: 213, 2: 3037, 3: 17767, 4: 67669}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036407730_1036407736 26 Left 1036407730 8:8470001-8470023 CCCAGACTTAAGCAATCCTCCTG 0: 8
1: 213
2: 3037
3: 17767
4: 67669
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036407730 Original CRISPR CAGGAGGATTGCTTAAGTCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr