ID: 1036407731

View in Genome Browser
Species Human (GRCh38)
Location 8:8470002-8470024
Sequence ACAGGAGGATTGCTTAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036407731_1036407736 25 Left 1036407731 8:8470002-8470024 CCAGACTTAAGCAATCCTCCTGT No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036407731 Original CRISPR ACAGGAGGATTGCTTAAGTC TGG (reversed) Intergenic
No off target data available for this crispr