ID: 1036407733

View in Genome Browser
Species Human (GRCh38)
Location 8:8470020-8470042
Sequence GCACTACAGGAGGCTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036407733_1036407736 7 Left 1036407733 8:8470020-8470042 CCTGTCTGAGCCTCCTGTAGTGC No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036407733 Original CRISPR GCACTACAGGAGGCTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr