ID: 1036407734

View in Genome Browser
Species Human (GRCh38)
Location 8:8470030-8470052
Sequence TGTAATCTCAGCACTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393056
Summary {0: 2, 1: 132, 2: 3002, 3: 36776, 4: 353144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036407734_1036407736 -3 Left 1036407734 8:8470030-8470052 CCTCCTGTAGTGCTGAGATTACA 0: 2
1: 132
2: 3002
3: 36776
4: 353144
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036407734 Original CRISPR TGTAATCTCAGCACTACAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr