ID: 1036407736

View in Genome Browser
Species Human (GRCh38)
Location 8:8470050-8470072
Sequence ACACTGTGAGCCACTGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036407730_1036407736 26 Left 1036407730 8:8470001-8470023 CCCAGACTTAAGCAATCCTCCTG 0: 8
1: 213
2: 3037
3: 17767
4: 67669
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data
1036407732_1036407736 10 Left 1036407732 8:8470017-8470039 CCTCCTGTCTGAGCCTCCTGTAG No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data
1036407733_1036407736 7 Left 1036407733 8:8470020-8470042 CCTGTCTGAGCCTCCTGTAGTGC No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data
1036407734_1036407736 -3 Left 1036407734 8:8470030-8470052 CCTCCTGTAGTGCTGAGATTACA 0: 2
1: 132
2: 3002
3: 36776
4: 353144
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data
1036407735_1036407736 -6 Left 1036407735 8:8470033-8470055 CCTGTAGTGCTGAGATTACACTG No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data
1036407731_1036407736 25 Left 1036407731 8:8470002-8470024 CCAGACTTAAGCAATCCTCCTGT No data
Right 1036407736 8:8470050-8470072 ACACTGTGAGCCACTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036407736 Original CRISPR ACACTGTGAGCCACTGCACA TGG Intergenic
No off target data available for this crispr