ID: 1036409329

View in Genome Browser
Species Human (GRCh38)
Location 8:8484275-8484297
Sequence CAGGGGAAGCAGGTTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036409329_1036409342 12 Left 1036409329 8:8484275-8484297 CCTTCCTTAACCTGCTTCCCCTG No data
Right 1036409342 8:8484310-8484332 CACAGTGGGAGGTACCAATCAGG No data
1036409329_1036409338 -3 Left 1036409329 8:8484275-8484297 CCTTCCTTAACCTGCTTCCCCTG No data
Right 1036409338 8:8484295-8484317 CTGGGAGGAACCACACACAGTGG No data
1036409329_1036409340 1 Left 1036409329 8:8484275-8484297 CCTTCCTTAACCTGCTTCCCCTG No data
Right 1036409340 8:8484299-8484321 GAGGAACCACACACAGTGGGAGG No data
1036409329_1036409339 -2 Left 1036409329 8:8484275-8484297 CCTTCCTTAACCTGCTTCCCCTG No data
Right 1036409339 8:8484296-8484318 TGGGAGGAACCACACACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036409329 Original CRISPR CAGGGGAAGCAGGTTAAGGA AGG (reversed) Intergenic
No off target data available for this crispr