ID: 1036414518

View in Genome Browser
Species Human (GRCh38)
Location 8:8534852-8534874
Sequence CTATCTCTCTAACAATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036414518_1036414522 24 Left 1036414518 8:8534852-8534874 CCTTCATATTGTTAGAGAGATAG No data
Right 1036414522 8:8534899-8534921 ATGATTGCAAAGATCCCTGGTGG No data
1036414518_1036414521 21 Left 1036414518 8:8534852-8534874 CCTTCATATTGTTAGAGAGATAG No data
Right 1036414521 8:8534896-8534918 GAAATGATTGCAAAGATCCCTGG No data
1036414518_1036414523 27 Left 1036414518 8:8534852-8534874 CCTTCATATTGTTAGAGAGATAG No data
Right 1036414523 8:8534902-8534924 ATTGCAAAGATCCCTGGTGGTGG No data
1036414518_1036414519 -9 Left 1036414518 8:8534852-8534874 CCTTCATATTGTTAGAGAGATAG No data
Right 1036414519 8:8534866-8534888 GAGAGATAGTTTTGACTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036414518 Original CRISPR CTATCTCTCTAACAATATGA AGG (reversed) Intergenic
No off target data available for this crispr