ID: 1036421697

View in Genome Browser
Species Human (GRCh38)
Location 8:8602106-8602128
Sequence TCAGCTAACTTATCAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036421691_1036421697 -4 Left 1036421691 8:8602087-8602109 CCTGTTTCCTTCCCCTTTGTCAG No data
Right 1036421697 8:8602106-8602128 TCAGCTAACTTATCAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036421697 Original CRISPR TCAGCTAACTTATCAGTTGA GGG Intergenic
No off target data available for this crispr