ID: 1036421698

View in Genome Browser
Species Human (GRCh38)
Location 8:8602107-8602129
Sequence CAGCTAACTTATCAGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036421692_1036421698 -10 Left 1036421692 8:8602094-8602116 CCTTCCCCTTTGTCAGCTAACTT No data
Right 1036421698 8:8602107-8602129 CAGCTAACTTATCAGTTGAGGGG No data
1036421691_1036421698 -3 Left 1036421691 8:8602087-8602109 CCTGTTTCCTTCCCCTTTGTCAG No data
Right 1036421698 8:8602107-8602129 CAGCTAACTTATCAGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036421698 Original CRISPR CAGCTAACTTATCAGTTGAG GGG Intergenic
No off target data available for this crispr