ID: 1036422829

View in Genome Browser
Species Human (GRCh38)
Location 8:8613906-8613928
Sequence GGAGGTGCCCGCGGGTAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036422829_1036422839 9 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422839 8:8613938-8613960 CCAGAGCCATAGTCAGAGGGAGG No data
1036422829_1036422841 15 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422841 8:8613944-8613966 CCATAGTCAGAGGGAGGCAGTGG No data
1036422829_1036422836 5 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422829_1036422837 6 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422837 8:8613935-8613957 GCACCAGAGCCATAGTCAGAGGG No data
1036422829_1036422842 19 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036422829 Original CRISPR GGAGGTGCCCGCGGGTAAGG CGG (reversed) Intergenic
No off target data available for this crispr