ID: 1036422834

View in Genome Browser
Species Human (GRCh38)
Location 8:8613924-8613946
Sequence TGGCTCTGGTGCCATTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036422834_1036422843 23 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data
1036422834_1036422844 24 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422844 8:8613971-8613993 AACGTAGATAAACAGCTTTAGGG No data
1036422834_1036422841 -3 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422841 8:8613944-8613966 CCATAGTCAGAGGGAGGCAGTGG No data
1036422834_1036422839 -9 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422839 8:8613938-8613960 CCAGAGCCATAGTCAGAGGGAGG No data
1036422834_1036422842 1 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036422834 Original CRISPR TGGCTCTGGTGCCATTGTGG AGG (reversed) Intergenic
No off target data available for this crispr