ID: 1036422835

View in Genome Browser
Species Human (GRCh38)
Location 8:8613927-8613949
Sequence CTATGGCTCTGGTGCCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036422835_1036422843 20 Left 1036422835 8:8613927-8613949 CCACAATGGCACCAGAGCCATAG No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data
1036422835_1036422844 21 Left 1036422835 8:8613927-8613949 CCACAATGGCACCAGAGCCATAG No data
Right 1036422844 8:8613971-8613993 AACGTAGATAAACAGCTTTAGGG No data
1036422835_1036422841 -6 Left 1036422835 8:8613927-8613949 CCACAATGGCACCAGAGCCATAG No data
Right 1036422841 8:8613944-8613966 CCATAGTCAGAGGGAGGCAGTGG No data
1036422835_1036422842 -2 Left 1036422835 8:8613927-8613949 CCACAATGGCACCAGAGCCATAG No data
Right 1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036422835 Original CRISPR CTATGGCTCTGGTGCCATTG TGG (reversed) Intergenic
No off target data available for this crispr