ID: 1036422836

View in Genome Browser
Species Human (GRCh38)
Location 8:8613934-8613956
Sequence GGCACCAGAGCCATAGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036422826_1036422836 8 Left 1036422826 8:8613903-8613925 CCCCCGCCTTACCCGCGGGCACC No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422830_1036422836 2 Left 1036422830 8:8613909-8613931 CCTTACCCGCGGGCACCTCCACA No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422829_1036422836 5 Left 1036422829 8:8613906-8613928 CCGCCTTACCCGCGGGCACCTCC No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422833_1036422836 -4 Left 1036422833 8:8613915-8613937 CCGCGGGCACCTCCACAATGGCA No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422828_1036422836 6 Left 1036422828 8:8613905-8613927 CCCGCCTTACCCGCGGGCACCTC No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422832_1036422836 -3 Left 1036422832 8:8613914-8613936 CCCGCGGGCACCTCCACAATGGC No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data
1036422827_1036422836 7 Left 1036422827 8:8613904-8613926 CCCCGCCTTACCCGCGGGCACCT No data
Right 1036422836 8:8613934-8613956 GGCACCAGAGCCATAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036422836 Original CRISPR GGCACCAGAGCCATAGTCAG AGG Intergenic
No off target data available for this crispr