ID: 1036422843

View in Genome Browser
Species Human (GRCh38)
Location 8:8613970-8613992
Sequence GAACGTAGATAAACAGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036422840_1036422843 3 Left 1036422840 8:8613944-8613966 CCATAGTCAGAGGGAGGCAGTGG No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data
1036422835_1036422843 20 Left 1036422835 8:8613927-8613949 CCACAATGGCACCAGAGCCATAG No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data
1036422834_1036422843 23 Left 1036422834 8:8613924-8613946 CCTCCACAATGGCACCAGAGCCA No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data
1036422838_1036422843 9 Left 1036422838 8:8613938-8613960 CCAGAGCCATAGTCAGAGGGAGG No data
Right 1036422843 8:8613970-8613992 GAACGTAGATAAACAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036422843 Original CRISPR GAACGTAGATAAACAGCTTT AGG Intergenic
No off target data available for this crispr