ID: 1036431681

View in Genome Browser
Species Human (GRCh38)
Location 8:8697978-8698000
Sequence GGTACTGGTTGGTGGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036431681_1036431693 14 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431693 8:8698015-8698037 CAGGAACTGGGCCACACAGTAGG No data
1036431681_1036431688 -5 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431688 8:8697996-8698018 GTACCAGTCTGTGGCCTGTCAGG No data
1036431681_1036431690 1 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431690 8:8698002-8698024 GTCTGTGGCCTGTCAGGAACTGG No data
1036431681_1036431695 27 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431695 8:8698028-8698050 ACACAGTAGGAGATGAGCCATGG No data
1036431681_1036431696 28 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431696 8:8698029-8698051 CACAGTAGGAGATGAGCCATGGG No data
1036431681_1036431691 2 Left 1036431681 8:8697978-8698000 CCCCTGGGCCACCAACCAGTACC No data
Right 1036431691 8:8698003-8698025 TCTGTGGCCTGTCAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036431681 Original CRISPR GGTACTGGTTGGTGGCCCAG GGG (reversed) Intergenic