ID: 1036432238

View in Genome Browser
Species Human (GRCh38)
Location 8:8702080-8702102
Sequence CGGGCGCGGGCGCCCAGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 2, 2: 2, 3: 54, 4: 441}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432238_1036432252 9 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432252 8:8702112-8702134 TTTCGGTCAGACCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432238_1036432259 25 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432259 8:8702128-8702150 CCGCGGGCTGGTTTCGATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1036432238_1036432251 8 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432251 8:8702111-8702133 GTTTCGGTCAGACCCGCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1036432238_1036432246 -8 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432246 8:8702095-8702117 CGCGCCCGGACCCGCGGTTTCGG 0: 1
1: 0
2: 0
3: 1
4: 30
1036432238_1036432257 24 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432238_1036432253 13 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432238 Original CRISPR CGGGCGCGGGCGCCCAGGGG CGG (reversed) Exonic