ID: 1036432241

View in Genome Browser
Species Human (GRCh38)
Location 8:8702084-8702106
Sequence GGTCCGGGCGCGGGCGCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432241_1036432257 20 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432241_1036432253 9 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1036432241_1036432252 5 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432252 8:8702112-8702134 TTTCGGTCAGACCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432241_1036432259 21 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432259 8:8702128-8702150 CCGCGGGCTGGTTTCGATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1036432241_1036432251 4 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432251 8:8702111-8702133 GTTTCGGTCAGACCCGCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1036432241_1036432260 29 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432260 8:8702136-8702158 TGGTTTCGATTAGGGCCAGTAGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432241 Original CRISPR GGTCCGGGCGCGGGCGCCCA GGG (reversed) Exonic