ID: 1036432242

View in Genome Browser
Species Human (GRCh38)
Location 8:8702085-8702107
Sequence GGGTCCGGGCGCGGGCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 451}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432242_1036432253 8 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1036432242_1036432259 20 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432259 8:8702128-8702150 CCGCGGGCTGGTTTCGATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1036432242_1036432257 19 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432242_1036432252 4 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432252 8:8702112-8702134 TTTCGGTCAGACCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432242_1036432251 3 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432251 8:8702111-8702133 GTTTCGGTCAGACCCGCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1036432242_1036432260 28 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432260 8:8702136-8702158 TGGTTTCGATTAGGGCCAGTAGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432242 Original CRISPR GGGTCCGGGCGCGGGCGCCC AGG (reversed) Exonic