ID: 1036432244

View in Genome Browser
Species Human (GRCh38)
Location 8:8702093-8702115
Sequence GAAACCGCGGGTCCGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432244_1036432252 -4 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432252 8:8702112-8702134 TTTCGGTCAGACCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432244_1036432259 12 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432259 8:8702128-8702150 CCGCGGGCTGGTTTCGATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1036432244_1036432257 11 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432244_1036432251 -5 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432251 8:8702111-8702133 GTTTCGGTCAGACCCGCCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1036432244_1036432253 0 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1036432244_1036432261 23 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432261 8:8702139-8702161 TTTCGATTAGGGCCAGTAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1036432244_1036432262 24 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432262 8:8702140-8702162 TTCGATTAGGGCCAGTAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1036432244_1036432263 27 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432263 8:8702143-8702165 GATTAGGGCCAGTAGGAGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 190
1036432244_1036432260 20 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432260 8:8702136-8702158 TGGTTTCGATTAGGGCCAGTAGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432244 Original CRISPR GAAACCGCGGGTCCGGGCGC GGG (reversed) Exonic