ID: 1036432247

View in Genome Browser
Species Human (GRCh38)
Location 8:8702099-8702121
Sequence CTGACCGAAACCGCGGGTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432247_1036432266 30 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432266 8:8702152-8702174 CAGTAGGAGGGCGGAGCGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 218
1036432247_1036432262 18 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432262 8:8702140-8702162 TTCGATTAGGGCCAGTAGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1036432247_1036432253 -6 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1036432247_1036432263 21 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432263 8:8702143-8702165 GATTAGGGCCAGTAGGAGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 190
1036432247_1036432264 26 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432264 8:8702148-8702170 GGGCCAGTAGGAGGGCGGAGCGG 0: 1
1: 0
2: 4
3: 31
4: 479
1036432247_1036432259 6 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432259 8:8702128-8702150 CCGCGGGCTGGTTTCGATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1036432247_1036432261 17 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432261 8:8702139-8702161 TTTCGATTAGGGCCAGTAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1036432247_1036432260 14 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432260 8:8702136-8702158 TGGTTTCGATTAGGGCCAGTAGG 0: 1
1: 0
2: 0
3: 1
4: 50
1036432247_1036432257 5 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432247_1036432252 -10 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432252 8:8702112-8702134 TTTCGGTCAGACCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432247 Original CRISPR CTGACCGAAACCGCGGGTCC GGG (reversed) Exonic