ID: 1036432257

View in Genome Browser
Species Human (GRCh38)
Location 8:8702127-8702149
Sequence CCCGCGGGCTGGTTTCGATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036432242_1036432257 19 Left 1036432242 8:8702085-8702107 CCTGGGCGCCCGCGCCCGGACCC 0: 1
1: 0
2: 5
3: 45
4: 451
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432245_1036432257 10 Left 1036432245 8:8702094-8702116 CCGCGCCCGGACCCGCGGTTTCG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432240_1036432257 21 Left 1036432240 8:8702083-8702105 CCCCTGGGCGCCCGCGCCCGGAC 0: 1
1: 0
2: 3
3: 18
4: 159
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432248_1036432257 4 Left 1036432248 8:8702100-8702122 CCGGACCCGCGGTTTCGGTCAGA 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432244_1036432257 11 Left 1036432244 8:8702093-8702115 CCCGCGCCCGGACCCGCGGTTTC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432247_1036432257 5 Left 1036432247 8:8702099-8702121 CCCGGACCCGCGGTTTCGGTCAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432250_1036432257 -2 Left 1036432250 8:8702106-8702128 CCGCGGTTTCGGTCAGACCCGCC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432238_1036432257 24 Left 1036432238 8:8702080-8702102 CCGCCCCTGGGCGCCCGCGCCCG 0: 1
1: 2
2: 2
3: 54
4: 441
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432249_1036432257 -1 Left 1036432249 8:8702105-8702127 CCCGCGGTTTCGGTCAGACCCGC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1036432241_1036432257 20 Left 1036432241 8:8702084-8702106 CCCTGGGCGCCCGCGCCCGGACC 0: 1
1: 1
2: 1
3: 19
4: 219
Right 1036432257 8:8702127-8702149 CCCGCGGGCTGGTTTCGATTAGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036432257 Original CRISPR CCCGCGGGCTGGTTTCGATT AGG Exonic