ID: 1036438729

View in Genome Browser
Species Human (GRCh38)
Location 8:8760808-8760830
Sequence ATGGAAAATCCCAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036438729_1036438734 -6 Left 1036438729 8:8760808-8760830 CCCACCACCTTGGGATTTTCCAT No data
Right 1036438734 8:8760825-8760847 TTCCATTAAACCTGGCTTTATGG No data
1036438729_1036438735 -5 Left 1036438729 8:8760808-8760830 CCCACCACCTTGGGATTTTCCAT No data
Right 1036438735 8:8760826-8760848 TCCATTAAACCTGGCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036438729 Original CRISPR ATGGAAAATCCCAAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr