ID: 1036440340

View in Genome Browser
Species Human (GRCh38)
Location 8:8776210-8776232
Sequence CACTGATTAATGCAACCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036440340_1036440344 -5 Left 1036440340 8:8776210-8776232 CCCACGGGTTGCATTAATCAGTG No data
Right 1036440344 8:8776228-8776250 CAGTGGGATCACATTAGACCAGG No data
1036440340_1036440345 3 Left 1036440340 8:8776210-8776232 CCCACGGGTTGCATTAATCAGTG No data
Right 1036440345 8:8776236-8776258 TCACATTAGACCAGGAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036440340 Original CRISPR CACTGATTAATGCAACCCGT GGG (reversed) Intergenic
No off target data available for this crispr