ID: 1036440344

View in Genome Browser
Species Human (GRCh38)
Location 8:8776228-8776250
Sequence CAGTGGGATCACATTAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036440339_1036440344 5 Left 1036440339 8:8776200-8776222 CCTGGTCTCTCCCACGGGTTGCA No data
Right 1036440344 8:8776228-8776250 CAGTGGGATCACATTAGACCAGG No data
1036440340_1036440344 -5 Left 1036440340 8:8776210-8776232 CCCACGGGTTGCATTAATCAGTG No data
Right 1036440344 8:8776228-8776250 CAGTGGGATCACATTAGACCAGG No data
1036440341_1036440344 -6 Left 1036440341 8:8776211-8776233 CCACGGGTTGCATTAATCAGTGG No data
Right 1036440344 8:8776228-8776250 CAGTGGGATCACATTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036440344 Original CRISPR CAGTGGGATCACATTAGACC AGG Intergenic
No off target data available for this crispr