ID: 1036440345

View in Genome Browser
Species Human (GRCh38)
Location 8:8776236-8776258
Sequence TCACATTAGACCAGGAGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036440341_1036440345 2 Left 1036440341 8:8776211-8776233 CCACGGGTTGCATTAATCAGTGG No data
Right 1036440345 8:8776236-8776258 TCACATTAGACCAGGAGTCCCGG No data
1036440340_1036440345 3 Left 1036440340 8:8776210-8776232 CCCACGGGTTGCATTAATCAGTG No data
Right 1036440345 8:8776236-8776258 TCACATTAGACCAGGAGTCCCGG No data
1036440339_1036440345 13 Left 1036440339 8:8776200-8776222 CCTGGTCTCTCCCACGGGTTGCA No data
Right 1036440345 8:8776236-8776258 TCACATTAGACCAGGAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036440345 Original CRISPR TCACATTAGACCAGGAGTCC CGG Intergenic
No off target data available for this crispr