ID: 1036440647

View in Genome Browser
Species Human (GRCh38)
Location 8:8778830-8778852
Sequence TGGCCCTACTTTGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036440644_1036440647 -1 Left 1036440644 8:8778808-8778830 CCTGAGACTGCATTGGAGTACAT No data
Right 1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG No data
1036440641_1036440647 23 Left 1036440641 8:8778784-8778806 CCATCTGTGCCTCAATTACAAAC No data
Right 1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG No data
1036440642_1036440647 14 Left 1036440642 8:8778793-8778815 CCTCAATTACAAACGCCTGAGAC No data
Right 1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036440647 Original CRISPR TGGCCCTACTTTGGAAAAAC TGG Intergenic
No off target data available for this crispr