ID: 1036442939

View in Genome Browser
Species Human (GRCh38)
Location 8:8797420-8797442
Sequence CTCGCTCGCTGCCGTTCTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036442936_1036442939 -8 Left 1036442936 8:8797405-8797427 CCAAGGCAACATTTACTCGCTCG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1036442939 8:8797420-8797442 CTCGCTCGCTGCCGTTCTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036442939 Original CRISPR CTCGCTCGCTGCCGTTCTTG GGG Exonic
900790894 1:4679905-4679927 CTGGCTGGCTGCAGATCTTGGGG - Intronic
1084145520 11:67263155-67263177 CGCGCGCCCTGCCGTTCCTGTGG - Intergenic
1096781485 12:53994765-53994787 CTCGCGCGCTGCCGCTCGCGGGG - Intronic
1103414742 12:120736722-120736744 CTTGCTCGCTGCCGTGGCTGTGG + Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1114431819 14:22667900-22667922 CTCTCTTGCTCCTGTTCTTGTGG - Intergenic
1120848404 14:89146822-89146844 CTTGCTCACTGCCCATCTTGGGG - Intronic
1121453601 14:94024847-94024869 CTCACTCTCTGCCCTTCTTCAGG - Intergenic
1122703690 14:103607141-103607163 CTCCCTCGCTGCGGTTTCTGCGG - Intronic
1132870962 16:2115599-2115621 CAGGCTCGCTGCCGTTCTCCGGG + Exonic
1134521567 16:14921284-14921306 CAGGCTCGCTGCCGTTCTCCGGG - Intronic
1134709238 16:16319935-16319957 CAGGCTCGCTGCCGTTCTCCGGG - Intergenic
1134716447 16:16359964-16359986 CAGGCTCGCTGCCGTTCTCCGGG - Intergenic
1134950367 16:18348710-18348732 CAGGCTCGCTGCCGTTCTCCGGG + Intergenic
1134958303 16:18392195-18392217 CAGGCTCGCTGCCGTTCTCCGGG + Intergenic
1155109268 18:22697816-22697838 CTCACTCCCTGCTGTGCTTGGGG - Intergenic
1159171878 18:64780919-64780941 CTTCCTCACTGCTGTTCTTGTGG + Intergenic
1165129408 19:33622537-33622559 CTCACTCGCTGCCGCGCTTCTGG + Intronic
927294445 2:21438245-21438267 CTAGCTCCATGCTGTTCTTGTGG + Intergenic
947016776 2:225629790-225629812 ATGGCTTGCTGCTGTTCTTGAGG - Intronic
1175217394 20:57398721-57398743 CTGGCTCGCTGCTGGGCTTGGGG + Intronic
1180008024 21:45032355-45032377 CTCCCTTGCTGCTGGTCTTGGGG + Intergenic
973930882 4:55792127-55792149 ATGGCTTGCTGCCCTTCTTGTGG + Intergenic
985475404 5:76151-76173 CACGCTCTCTGCTGCTCTTGTGG + Intergenic
994775482 5:104032622-104032644 CCCCCTCTCTGCCTTTCTTGGGG + Intergenic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
1004783188 6:18935632-18935654 CTCGCTCGCTTTCTGTCTTGTGG + Intergenic
1011267987 6:85545214-85545236 CTCCTTTGCTGCCTTTCTTGAGG - Intronic
1015141929 6:129944155-129944177 CTCCCTCGCTCCCGTTCACGAGG + Intergenic
1019427200 7:983315-983337 CTCGCCCGCTGCCGCTCGTCGGG + Exonic
1028903565 7:96127987-96128009 CTTGCTCACTGCCCTTCTTGGGG + Intronic
1036442939 8:8797420-8797442 CTCGCTCGCTGCCGTTCTTGGGG + Exonic
1037828359 8:22173594-22173616 CTCTTTAGCTGCCTTTCTTGGGG + Exonic
1046695671 8:117336569-117336591 CTCATTGGCTGCTGTTCTTGGGG + Intergenic
1050813335 9:9778008-9778030 CTCTATCACTGCCTTTCTTGAGG - Intronic
1057934122 9:99222285-99222307 CTCGCCAGCTGCCGGTCTTTCGG + Exonic
1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG + Exonic
1060727473 9:126016038-126016060 CACGCTCTCTGCCGTGGTTGTGG + Intergenic
1062526215 9:136978979-136979001 GTCGCTCGCCGCAGTTCCTGGGG + Exonic
1186557305 X:10573470-10573492 ATCGCTTGATGCCCTTCTTGAGG - Intronic
1196791196 X:119466967-119466989 TTCGATCGCTGGGGTTCTTGAGG + Intergenic