ID: 1036445700

View in Genome Browser
Species Human (GRCh38)
Location 8:8820260-8820282
Sequence AGCACAGCAGTCCCAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036445700_1036445702 -2 Left 1036445700 8:8820260-8820282 CCCAGGGTTGGGACTGCTGTGCT 0: 1
1: 0
2: 3
3: 25
4: 233
Right 1036445702 8:8820281-8820303 CTCCCCCTTCTCAAGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036445700 Original CRISPR AGCACAGCAGTCCCAACCCT GGG (reversed) Intronic
900070793 1:770259-770281 AGCCCAGCAGTGCCTTCCCTTGG - Intergenic
902416983 1:16245646-16245668 AGCACAGCACTCCCCAGCCAGGG - Intergenic
902690059 1:18105571-18105593 AACACACCAGCCCCAATCCTTGG + Intergenic
902851542 1:19161763-19161785 AGCTCAGAAGTCCCAACAATCGG + Intronic
904276035 1:29384829-29384851 AGCACGTCTGTCCCAGCCCTAGG - Intergenic
904524541 1:31122899-31122921 AGCACAGCATTCCCACTCCCTGG + Intergenic
905337954 1:37258257-37258279 AGCACATCAGCCCCAGCCCCAGG + Intergenic
907872108 1:58452891-58452913 AGCTCAGCAGTCCCATTCCTAGG + Intronic
908777459 1:67654550-67654572 AACCCAGCAATCCCATCCCTGGG - Intergenic
913448858 1:118978891-118978913 AACACAGCAGTGCCTTCCCTGGG - Intronic
915904515 1:159868024-159868046 AGAACAGCAGGCCCAGCCCAAGG + Intronic
916777436 1:167981891-167981913 AACCCAGCAATCCCAATCCTGGG - Intronic
916869711 1:168900084-168900106 ATTACAGCACTCCCAAGCCTAGG - Intergenic
917307363 1:173640294-173640316 AGCACACCAGCACCAACCCAGGG + Intronic
918276341 1:182956717-182956739 AGCCCAGCAATCCCATTCCTGGG + Intergenic
920069870 1:203295130-203295152 AGCACAGCACTCCAGAGCCTGGG + Intergenic
920342434 1:205284100-205284122 AGCACAGCAGTCCCCCACCAGGG + Intergenic
921439499 1:215168331-215168353 AGAACAGCAGTCCCATTACTGGG + Intronic
922106152 1:222515675-222515697 AGCCCAGCAGTGCCTTCCCTTGG - Intergenic
923463599 1:234229073-234229095 AGCACAGTAGTCCCTACCACAGG + Intronic
924173422 1:241365036-241365058 ATCAGAGCAGTCCCAGCCATTGG + Intergenic
924348332 1:243093242-243093264 AGCCCAGCAGTGCCTTCCCTTGG - Intergenic
924368532 1:243322041-243322063 AACACAGCAATCCCATTCCTGGG - Intronic
924894214 1:248318046-248318068 AGCACAGCAAGCCCCACCCAAGG + Intergenic
1063844787 10:10114595-10114617 GACACAGAAATCCCAACCCTGGG - Intergenic
1066153196 10:32647095-32647117 AGCCCAGCAGTCCCATTACTGGG - Intronic
1066351347 10:34640184-34640206 AGCACACCTGCCCCATCCCTGGG + Intronic
1066728032 10:38411659-38411681 AGCCCAGCAGTGCCTTCCCTTGG + Intergenic
1067059088 10:43068615-43068637 AGCTGAGCACTCCCAGCCCTGGG + Intergenic
1068772126 10:60833755-60833777 AGCCCAGCATTCCCACTCCTAGG - Intergenic
1069805890 10:71124834-71124856 AGCACCTCAGCCCCAACCCAGGG - Intergenic
1071883101 10:89920807-89920829 AGCACAGCAGACAAAAACCTGGG - Intergenic
1073043669 10:100623765-100623787 AGAAAAGCAGCCCCAGCCCTTGG - Intergenic
1076804746 10:132849775-132849797 TGCACAGCAGGGCCAGCCCTAGG - Intronic
1076923938 10:133471866-133471888 AGCAGAGCAGCCCCCAGCCTTGG + Intergenic
1077018806 11:408377-408399 AGAACAGCCGTCCCAGTCCTGGG + Intronic
1077456948 11:2687027-2687049 AACTCAGCAGTCCCAGCTCTGGG + Intronic
1077669608 11:4145587-4145609 ACCACAGTAGACCCTACCCTGGG - Intergenic
1080389931 11:31835661-31835683 AGATCAGCAGAACCAACCCTGGG - Intronic
1081975468 11:47231779-47231801 AGCACAGTAATCCCAACACCTGG - Intronic
1083235630 11:61349084-61349106 AGCACAGCAGTCTGAAGCTTGGG + Exonic
1083296030 11:61716114-61716136 AGCACCTCAGTCCCACCCCATGG - Intronic
1086917761 11:92550643-92550665 AGCACAGCAGTCCTCATACTTGG + Intronic
1087324944 11:96710334-96710356 AGAGCAGCTGTCTCAACCCTGGG + Intergenic
1087482829 11:98722703-98722725 AGCACAGCAATTCCACTCCTAGG + Intergenic
1087921419 11:103871110-103871132 AGTACAGTAGTCCCCACCCTTGG - Intergenic
1090248294 11:125233420-125233442 AGCACCTCAGAACCAACCCTTGG - Intronic
1090825321 11:130381030-130381052 AGCACAACAGTCCAAACCCTGGG + Intergenic
1092294565 12:7188400-7188422 AGCACACAAATCCCAGCCCTTGG - Intergenic
1094265268 12:28551616-28551638 AGCCCAGCAGTCACAACTGTGGG - Intronic
1098059773 12:66549208-66549230 AGCACATCAGTCCCAAAACAGGG + Intronic
1100879941 12:99005241-99005263 CGCACTGCAGTCCCAGCACTGGG - Intronic
1101506385 12:105350362-105350384 TGCACAGCCCTCCCAGCCCTGGG - Intronic
1101544433 12:105698149-105698171 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1103205252 12:119123896-119123918 AGAACAGCAGACGAAACCCTGGG + Intronic
1106363486 13:29053927-29053949 AGCCCAGCAGTTCCATTCCTGGG - Intronic
1112302925 13:98246901-98246923 AACACAGGAGTTCCAGCCCTCGG - Intronic
1114894884 14:26975158-26975180 TGGACACCAGTCCCAACTCTGGG - Intergenic
1116114294 14:40628674-40628696 CTCACAGAAGTCCCAACCCTAGG - Intergenic
1118448269 14:65871540-65871562 AGCACAGCACTCACAGGCCTTGG - Intergenic
1119586016 14:75836018-75836040 AACCCAGCAGTCCCACTCCTAGG + Intronic
1121440745 14:93947589-93947611 AGCACAGCAGGCCCACCACGCGG - Intronic
1122194785 14:100076782-100076804 TCCACAGCCGACCCAACCCTTGG - Intronic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1125000339 15:34763288-34763310 ACCACAGCCTTCCCAACCTTTGG - Intergenic
1125274669 15:37978132-37978154 AGTACAGTTGTCCCAACCCTTGG - Intergenic
1126222328 15:46228761-46228783 AACACATCCGTCACAACCCTTGG - Intergenic
1127393744 15:58527281-58527303 AGCACAGCGGTTCCTATCCTAGG - Intronic
1127694595 15:61433034-61433056 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1129624666 15:77184445-77184467 AGCCCAGCAATCCCACTCCTAGG + Intronic
1132513349 16:354512-354534 AGCACAGAAGTCCCAGCTCCAGG + Intergenic
1133022069 16:2971152-2971174 AGCCCAGCAGGGCCAGCCCTAGG - Exonic
1133130053 16:3671427-3671449 AGGGCTGCAGTCACAACCCTGGG + Intronic
1133278925 16:4654207-4654229 AACACAGAACTCCAAACCCTTGG - Intronic
1133282778 16:4676555-4676577 AGAACAGCAGTCTCTGCCCTCGG - Intronic
1133843095 16:9428331-9428353 AGCAAAGAAGTCCCAAGCCTTGG - Intergenic
1133875133 16:9726938-9726960 TGCACAGCAGACCCCACACTGGG + Intergenic
1136019802 16:27432846-27432868 ATCACAGCACTCCCTCCCCTAGG - Intronic
1137359221 16:47797759-47797781 CCCACAGCAGTCACACCCCTTGG - Intergenic
1137858164 16:51817714-51817736 AGCCCAGCAGTCCCACTACTGGG - Intergenic
1138165946 16:54801839-54801861 AGCAAAGATGTGCCAACCCTGGG + Intergenic
1138427714 16:56947281-56947303 AGCACAGCACTCCCAGCCTCAGG + Intergenic
1140324492 16:73988502-73988524 AGCCCAGCAATCCCATCACTGGG + Intergenic
1144642842 17:16947825-16947847 AGCACAGCAATCCCATTACTGGG + Intronic
1145206451 17:20986789-20986811 AGCACAGCAATCCCATCACTGGG + Intergenic
1145975485 17:28981595-28981617 AGCATGGCAGTGCCCACCCTAGG - Exonic
1146001666 17:29134056-29134078 AACATAGCACTCCCTACCCTTGG + Intronic
1146797855 17:35795456-35795478 CGCAGAGCAGTCCCATCCCCGGG - Exonic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1148837596 17:50474073-50474095 GGCAGAGCAATCCCCACCCTGGG - Intronic
1150335372 17:64326760-64326782 AGCACAGCAAGCCCAGACCTTGG - Intronic
1150400258 17:64850770-64850792 AGCACAACACTTCCAACCATAGG - Intergenic
1150786824 17:68169927-68169949 ACCACTGCACTCCCCACCCTGGG + Intergenic
1153507299 18:5814293-5814315 AGAACAGGGGTCCCAACCCCTGG - Intergenic
1157204609 18:45687716-45687738 AGCAGAGCATTACAAACCCTGGG + Intergenic
1159654464 18:71015283-71015305 GGCTCAGCAGTCCCAGTCCTAGG - Intergenic
1160651860 19:235187-235209 AGCCCAGCAGTGCCTTCCCTTGG - Intergenic
1160663874 19:313797-313819 AGCACAGCAGCACCAAGCCCAGG - Intronic
1161953034 19:7478208-7478230 AGCACAACAGTCCCCAGCATGGG + Intronic
1162393973 19:10405388-10405410 AGCACAGCACCTCCAGCCCTGGG + Intronic
1164994894 19:32713815-32713837 AGCACAGCAGTCCTCAGCCTGGG + Intergenic
1165610285 19:37145764-37145786 AACACAGTAGTCCCACCCCTGGG - Intronic
1166262701 19:41652389-41652411 AGCTCAGCAGGCCTAACTCTGGG - Intronic
1166391748 19:42412389-42412411 AGACCAGCAGTCCCAGCCCAGGG - Intronic
1167771927 19:51526054-51526076 AGCACAGCTGCCTCAACCCAGGG + Intronic
1168212977 19:54905097-54905119 AGCCCAGCAATCCCATCGCTGGG - Intergenic
1168712992 19:58512330-58512352 AGCACAGAAATCCCTGCCCTTGG + Intronic
925098741 2:1228401-1228423 AGCACAGCTGTCCAGCCCCTGGG + Intronic
925361423 2:3283152-3283174 AGGCCAGCTGCCCCAACCCTTGG + Intronic
925432372 2:3806319-3806341 AGCACACCAGTAGCAACCGTGGG - Intronic
928901310 2:36320678-36320700 AGTCCAGCAGTCCCATTCCTGGG + Intergenic
929713949 2:44292202-44292224 TCCCCAGCAGTCCCTACCCTGGG - Intronic
929985129 2:46722693-46722715 GACCCAGCAATCCCAACCCTTGG - Intronic
931844811 2:66192642-66192664 TGAGCAGCAGTCCCAACCCTAGG + Intergenic
932506166 2:72233893-72233915 AGCCCAGCAGTCCCACTTCTGGG + Intronic
934768094 2:96891865-96891887 AGCTCAGCAGCCCCAACGCTGGG + Intronic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
936264224 2:110988538-110988560 AGCACAGCAATTCCATTCCTAGG - Intronic
936876588 2:117197154-117197176 ACAACAGCAGTCACAACACTAGG - Intergenic
938295355 2:130174943-130174965 TGCACAGCAGTGCCAAGACTTGG - Exonic
938374795 2:130798213-130798235 AGGACGGCGGTCCCAGCCCTAGG - Intergenic
938406218 2:131034760-131034782 GGCACAGCAGTCCTGGCCCTGGG - Intronic
939700925 2:145389473-145389495 AGCACAGCAATCCCATTACTGGG - Intergenic
940419254 2:153459401-153459423 AGCCCAGGAGTTCAAACCCTGGG + Intergenic
941413280 2:165186958-165186980 AGCACCCCTGTCCCAACCCTAGG - Intronic
945461614 2:210116181-210116203 AGCAGAGCAGTCCCTTCCCATGG - Intronic
946193007 2:218017308-218017330 AGCAGAGCAGGCCCAGCCCCAGG + Intergenic
946510093 2:220346681-220346703 AGCACAGGAATCCCAAGCATGGG + Intergenic
947298812 2:228665112-228665134 AGACCACCAGTCCCACCCCTGGG - Intergenic
1169278984 20:4251159-4251181 AGCACCCCAGCCCCAGCCCTAGG - Intergenic
1169289505 20:4336709-4336731 AGCACAGCAATCCTAAAGCTGGG - Intergenic
1169337513 20:4768733-4768755 ACCACGGCACTCCCTACCCTGGG - Intergenic
1169445572 20:5668566-5668588 GGCACAGCAGTTCCAAGCCAAGG + Intergenic
1169873883 20:10275156-10275178 ACCTCATCATTCCCAACCCTTGG + Intronic
1170492663 20:16894542-16894564 AGCCCAGCAATCCCATTCCTGGG + Intergenic
1170716434 20:18835386-18835408 GGCACAGCAGTTCCAATTCTAGG - Intergenic
1170759023 20:19233258-19233280 CACACAGCAGTTCCAAGCCTGGG + Intronic
1170784641 20:19456829-19456851 AACACACCAGTCACCACCCTGGG + Intronic
1171774854 20:29355558-29355580 ACCACAGCAGCCCTAGCCCTAGG + Intergenic
1171816860 20:29793188-29793210 ACCACAGCAGCCCTAGCCCTAGG + Intergenic
1173133808 20:40421484-40421506 TGTGCACCAGTCCCAACCCTAGG + Intergenic
1173857317 20:46258646-46258668 AGGAGAGCAGCCCCAACCCTGGG + Intronic
1174248491 20:49200110-49200132 AACCCAGCAGTCCCAGTCCTAGG + Intergenic
1175494425 20:59403918-59403940 AGCACAGCGGTCGCACCCCCCGG + Intergenic
1175959170 20:62626384-62626406 CCCACCGCAGTCCCAACCCAGGG + Intergenic
1176154430 20:63611151-63611173 AGCACTGCTGTCCCCAGCCTGGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176308227 21:5135487-5135509 AGCACAGCAGACCCACTCCTGGG - Intronic
1179588473 21:42389217-42389239 GGCACAGCAGCCCCACCCCTTGG - Intronic
1179848833 21:44126545-44126567 AGCACAGCAGACCCACTCCTGGG + Intronic
1180018518 21:45103680-45103702 AATACAGGAGTCCCAACCCCTGG - Intronic
1180281954 22:10708125-10708147 AGCACAGCAGGCAAAACCATGGG + Intergenic
1180832761 22:18914477-18914499 AGCACTGGGGTCCCCACCCTGGG + Intronic
1181565323 22:23733315-23733337 AACCCAGCAGCTCCAACCCTAGG - Intergenic
1181688048 22:24542910-24542932 ACCCCAGCAGCCCCAAGCCTGGG + Exonic
1182398693 22:30057211-30057233 AGCCCAGCAGTTCCCAGCCTGGG + Intergenic
1182445781 22:30388403-30388425 CTCCCAGCAGCCCCAACCCTTGG - Intronic
1183464997 22:37975274-37975296 ACCACAGCACTTCCAACTCTGGG - Intronic
1184066678 22:42125489-42125511 AGGACAGCAGTCCCTGCCCTTGG + Intergenic
1184069146 22:42137641-42137663 AGGACAGCAGTCCCTGCCCTTGG + Intergenic
1184410279 22:44322308-44322330 GGCAGAGCACTCCCATCCCTGGG + Intergenic
1184415244 22:44348375-44348397 ACCACAGCAGTCCAACCCGTGGG - Intergenic
1184530535 22:45052420-45052442 AGCAATGCAGTCCCCTCCCTGGG - Intergenic
1185024974 22:48403647-48403669 AGGACACCAGCCCCAACCATTGG - Intergenic
1203282846 22_KI270734v1_random:139781-139803 AGCACTGGGGTCCCCACCCTGGG + Intergenic
949169392 3:980539-980561 CACACAGAAGTCCCAGCCCTGGG + Intergenic
953040442 3:39251121-39251143 AGCATGGCAGTTCCAATCCTGGG + Intergenic
955100088 3:55840184-55840206 AGTAAAGCAGTCCCCACACTAGG + Intronic
956658037 3:71570903-71570925 AGCACAGCTGGCCCCAGCCTGGG + Intronic
956700663 3:71956116-71956138 AGAGCAGCACCCCCAACCCTGGG + Intergenic
959417029 3:106087783-106087805 AGCACATCAGCCCTAAGCCTGGG - Intergenic
959840287 3:110967207-110967229 AGCACACCAGCACCAACCCAGGG - Intergenic
964047210 3:152343289-152343311 AGGACTGGAGTCCCAACCGTTGG - Intronic
966816547 3:183894541-183894563 AACCCAGCAGTCCCAATCTTAGG - Intergenic
968607634 4:1543010-1543032 ATCACAGCAGCCCCAACCCAGGG + Intergenic
971745481 4:30574440-30574462 AGGCCAGAAGTCCAAACCCTAGG - Intergenic
972963372 4:44480792-44480814 AGCCCAGCAATTCCACCCCTGGG + Intergenic
973142072 4:46781749-46781771 GGCTCAGCAGGCCCCACCCTTGG + Intronic
974560084 4:63506214-63506236 AGCACAGCAGTCTCCAGACTGGG + Intergenic
976668016 4:87621127-87621149 AGCACAGCAGTCCCTGGCCAGGG - Intergenic
977340026 4:95745602-95745624 AGCACAGCATTCTCAGTCCTGGG + Intergenic
978746979 4:112206297-112206319 AACTAAGCAGTCTCAACCCTTGG + Intergenic
979255008 4:118599939-118599961 AGCCCAGCAGTGCCTTCCCTTGG + Intergenic
980269748 4:130568695-130568717 AGCACACCATTCCAAAGCCTTGG + Intergenic
984848170 4:184125530-184125552 AGCACATCAACCCCACCCCTGGG + Intronic
985887204 5:2688884-2688906 AGCACAGCCAAGCCAACCCTAGG + Intergenic
986949893 5:13070592-13070614 AGCAGAGCTGTCCAAAGCCTTGG - Intergenic
988779013 5:34502438-34502460 AACACAGCAGACCCATCGCTGGG + Intergenic
990665152 5:58063521-58063543 AGCAGAGCAGACCCACCCCTGGG - Intergenic
990797019 5:59554979-59555001 AACTCAGCAGTCCCATTCCTGGG + Intronic
992867568 5:80973211-80973233 ATCACAGAAGACCCAACCATAGG + Intronic
993014849 5:82523792-82523814 AGCAAACCACTCTCAACCCTAGG - Intergenic
993596114 5:89858210-89858232 ACCACAGCCATCCCAACCTTCGG - Intergenic
994057530 5:95435171-95435193 AGCACAGTAGTCACAGCCCTTGG + Intronic
994132619 5:96247709-96247731 ATCACAGCAATACAAACCCTTGG + Intergenic
996503572 5:124243524-124243546 AGCACTGTAATCCCAAGCCTTGG + Intergenic
997846379 5:137290077-137290099 AGCCCAGCAACTCCAACCCTAGG + Intronic
998043452 5:138968155-138968177 AGCATAGCAGGCCCTGCCCTGGG + Intronic
998393870 5:141805872-141805894 GGCACAGCAGTCCCTCCCCGAGG + Intergenic
999331893 5:150679178-150679200 AGCACAGCAGAACCAACCTGAGG - Exonic
1000347509 5:160327232-160327254 ATAACAGCAGTGCCTACCCTTGG + Intronic
1000919163 5:167117977-167117999 AACACCGCAGTCCTAATCCTAGG + Intergenic
1002725196 5:181290005-181290027 AGCCCAGCAGTGCCTTCCCTTGG + Intergenic
1004307300 6:14512578-14512600 AGCACTGCAGACCCATTCCTGGG - Intergenic
1005361660 6:25036815-25036837 AGAACAGGAGTCACACCCCTAGG + Intronic
1006746129 6:36343442-36343464 AGAACAGCTTTGCCAACCCTTGG - Intergenic
1007190012 6:40006048-40006070 ATCACAGCTTTCCCAACTCTTGG + Intergenic
1008011078 6:46468501-46468523 AGCAAAGCAGCCCCCATCCTGGG + Intronic
1008130365 6:47714119-47714141 AGCATAGCTTTCCCAACCTTGGG + Exonic
1011753750 6:90478510-90478532 AGCTCAACAGCCCCATCCCTAGG - Intergenic
1011766265 6:90623380-90623402 AGCACAGCAGTCTGAAGTCTGGG + Intergenic
1012988759 6:105903419-105903441 AGGACTGCAGTTCTAACCCTTGG - Intergenic
1015330411 6:131972124-131972146 AGCACAGTAGTTCCAAGTCTGGG + Intergenic
1015818684 6:137237097-137237119 GACCCAGCAGTCCCACCCCTAGG - Intergenic
1016683517 6:146856657-146856679 AGCTCAGGAGTCCCAACGCTTGG + Intergenic
1019024640 6:168948773-168948795 AGCAAACCATTCCAAACCCTTGG - Intergenic
1019628624 7:2034657-2034679 GCCACAGCAGTCCCCACACTCGG + Intronic
1019821408 7:3245926-3245948 GTCCCAGCAGTCCCAACTCTGGG - Intergenic
1020014935 7:4825308-4825330 AGCACTGGAGTCCCACTCCTGGG + Intronic
1020426280 7:8069504-8069526 AGCACAGCTGCCCCACCCCCTGG - Intronic
1020449852 7:8308492-8308514 AGCCCAGCAATCCCATTCCTGGG - Intergenic
1023900021 7:44468659-44468681 AACACAGCAGGCCCAGCTCTTGG + Intronic
1026183193 7:68060444-68060466 TGCACAGCTATCCCTACCCTTGG + Intergenic
1026423088 7:70260673-70260695 AGTGCAGCAGTCCCACTCCTAGG + Intronic
1028728013 7:94111042-94111064 AGCATACCAGTTCCAAACCTAGG + Intergenic
1029954454 7:104622822-104622844 AGCCCAGCAATCCCACTCCTAGG - Intronic
1031608231 7:123794603-123794625 AGAACATAAGTCCCAAGCCTTGG + Intergenic
1032582078 7:133112750-133112772 AGCACAGCACACCCTACCTTGGG - Intergenic
1033287641 7:140056479-140056501 AGCACAGCATTCCTAACTTTGGG + Intronic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1034765116 7:153713160-153713182 AGCCCAGCAGTCCCATTACTGGG + Intergenic
1035584230 8:759524-759546 TGCACACCCGTCCCAACCCCAGG - Intergenic
1036445700 8:8820260-8820282 AGCACAGCAGTCCCAACCCTGGG - Intronic
1036692530 8:10952780-10952802 AGCACAGGGCTCCCAACCCCCGG + Intronic
1037910721 8:22742115-22742137 AGGACACCAGGCCCACCCCTAGG + Intronic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1042694895 8:71546033-71546055 AGCACATCAGTGTCTACCCTAGG + Intronic
1043912128 8:85875394-85875416 AGCACAGCTGTCCCCTCCCAAGG + Intergenic
1044784691 8:95781632-95781654 AGGACAGAAGCCCCAAGCCTTGG + Intergenic
1045174454 8:99706807-99706829 AGCACTGTAGCCCCAACCCAAGG + Intronic
1046379867 8:113436803-113436825 AGCAAAGGAATCCAAACCCTGGG - Exonic
1047254465 8:123205541-123205563 AGCAGGGAACTCCCAACCCTGGG + Intronic
1047307681 8:123666215-123666237 AGCACAGCAGTTCCCACCCTTGG - Intergenic
1047938868 8:129808144-129808166 AGCAGAGCTGGCCAAACCCTTGG + Intergenic
1048044966 8:130764817-130764839 AGCACAGTTGTCACAAACCTGGG - Intergenic
1049344380 8:142130577-142130599 AGCCCTGCAGTCCCATCCCAGGG + Intergenic
1050125367 9:2351855-2351877 AGTTCAGCACTCCCATCCCTGGG - Intergenic
1052270264 9:26621073-26621095 GGCACAGCAGGCAAAACCCTGGG - Intergenic
1053648588 9:40140612-40140634 AGCAGAGCAGCCCCAGGCCTTGG - Intergenic
1053757158 9:41323230-41323252 AGCAGAGCAGCCCCAGGCCTTGG + Intergenic
1054535995 9:66235558-66235580 AGCAGAGCAGCCCCAGGCCTTGG + Intergenic
1059472694 9:114518514-114518536 AGCTCAGCAGTTCTAATCCTAGG - Intergenic
1060477292 9:123996453-123996475 TGCACAGCAGTCTCAAAACTAGG - Intergenic
1061043277 9:128151577-128151599 AGCACAGGAGGCCCAAGCCTGGG + Intronic
1062023690 9:134330748-134330770 AGGACAGAAGGCCCAACCCCAGG - Intronic
1186204604 X:7188256-7188278 AGCACAGCATTCCTAAACCTTGG + Intergenic
1187934460 X:24322143-24322165 AGGATTCCAGTCCCAACCCTAGG - Intergenic
1192459007 X:71301488-71301510 ACCACAGCAATTCCAAGCCTTGG - Intergenic
1192789917 X:74371360-74371382 ATAACTGCTGTCCCAACCCTAGG + Intergenic
1197076376 X:122358272-122358294 AACACAGCAGTCCCATTACTGGG - Intergenic
1197699235 X:129585289-129585311 AGCACAGCTGTCTCAAACCTTGG - Intronic
1200290012 X:154862899-154862921 AACCCAGCAGTCCCATCACTGGG - Intronic