ID: 1036447313

View in Genome Browser
Species Human (GRCh38)
Location 8:8833118-8833140
Sequence TGGTGAATTCTCATGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2277
Summary {0: 1, 1: 0, 2: 34, 3: 518, 4: 1724}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036447313_1036447317 -2 Left 1036447313 8:8833118-8833140 CCAGATCCCATGAGAATTCACCA 0: 1
1: 0
2: 34
3: 518
4: 1724
Right 1036447317 8:8833139-8833161 CATCGTGACAACACCACCAAAGG No data
1036447313_1036447320 1 Left 1036447313 8:8833118-8833140 CCAGATCCCATGAGAATTCACCA 0: 1
1: 0
2: 34
3: 518
4: 1724
Right 1036447320 8:8833142-8833164 CGTGACAACACCACCAAAGGGGG No data
1036447313_1036447319 0 Left 1036447313 8:8833118-8833140 CCAGATCCCATGAGAATTCACCA 0: 1
1: 0
2: 34
3: 518
4: 1724
Right 1036447319 8:8833141-8833163 TCGTGACAACACCACCAAAGGGG No data
1036447313_1036447321 6 Left 1036447313 8:8833118-8833140 CCAGATCCCATGAGAATTCACCA 0: 1
1: 0
2: 34
3: 518
4: 1724
Right 1036447321 8:8833147-8833169 CAACACCACCAAAGGGGGACTGG No data
1036447313_1036447318 -1 Left 1036447313 8:8833118-8833140 CCAGATCCCATGAGAATTCACCA 0: 1
1: 0
2: 34
3: 518
4: 1724
Right 1036447318 8:8833140-8833162 ATCGTGACAACACCACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036447313 Original CRISPR TGGTGAATTCTCATGGGATC TGG (reversed) Intronic
Too many off-targets to display for this crispr