ID: 1036450783

View in Genome Browser
Species Human (GRCh38)
Location 8:8865407-8865429
Sequence CTGGATACAAAAATCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036450779_1036450783 24 Left 1036450779 8:8865360-8865382 CCACTTAGTTTAAGAAACAAAAC 0: 1
1: 2
2: 7
3: 55
4: 452
Right 1036450783 8:8865407-8865429 CTGGATACAAAAATCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036450783 Original CRISPR CTGGATACAAAAATCAGAAA TGG Intronic
No off target data available for this crispr