ID: 1036451142

View in Genome Browser
Species Human (GRCh38)
Location 8:8868786-8868808
Sequence GAAGTAGCGATGACTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036451142 Original CRISPR GAAGTAGCGATGACTATGGG TGG (reversed) Intronic
900938242 1:5780675-5780697 GAAGTTCCCATGACTTTGGGTGG + Intergenic
901492190 1:9602279-9602301 GAAGCAGCCATGACTGCGGGGGG + Intronic
901976670 1:12950178-12950200 CGAGTAGCTAGGACTATGGGTGG - Intronic
901997873 1:13168095-13168117 CGAGTAGCTAGGACTATGGGTGG + Intergenic
902016592 1:13312982-13313004 CGAGTAGCTAGGACTATGGGTGG + Intronic
902792288 1:18777625-18777647 GAAGGAGCGAGGACTGTGGGGGG - Intergenic
906416444 1:45623808-45623830 GCAGAAGCGCTGAGTATGGGTGG + Exonic
911165704 1:94722554-94722576 AAAGCAGCCATGACTATGGAAGG - Intergenic
913105865 1:115613514-115613536 GAAATAAGGAAGACTATGGGAGG - Intergenic
914099705 1:144572857-144572879 GAAGTAGAGATGTGTTTGGGGGG - Intergenic
916240246 1:162632174-162632196 GAAGTGGAGATGGATATGGGTGG + Intronic
922516464 1:226211794-226211816 CAAGTAGCTAGGACTATAGGTGG - Intergenic
924462225 1:244269672-244269694 GGAGTAGCGGTGCCCATGGGAGG - Intergenic
1070534795 10:77368183-77368205 CAAGTAGTGATGAGGATGGGGGG - Intronic
1071120552 10:82272118-82272140 GGAGTAGAGATGACCATGGTAGG + Intronic
1075595145 10:123723888-123723910 GAAGTAGCGCTGGTTATGGGGGG - Intronic
1075920873 10:126211600-126211622 GAGGTAGAGATGACTACTGGAGG - Intronic
1077312671 11:1897678-1897700 GAAGTGGCGGTGACTGAGGGTGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1089252341 11:117174046-117174068 GGAGTAGCCATGCCTATGGGTGG - Intronic
1090518790 11:127457193-127457215 GAAGTGGAGATGAGGATGGGAGG - Intergenic
1091396676 12:157518-157540 GCAGTAGCGCTGGCTGTGGGGGG - Exonic
1092219766 12:6705006-6705028 GCAGGAGTGATGACTTTGGGTGG - Intergenic
1096410405 12:51373143-51373165 GAATTAGCTAAGACTTTGGGGGG + Intronic
1097881488 12:64690600-64690622 TAAGTAGCTAGGACTATAGGCGG + Intronic
1098579724 12:72085159-72085181 GCAGTAGGGGTGGCTATGGGTGG + Intronic
1103308080 12:119982165-119982187 GGAGTAGCTAAGACTATAGGTGG + Intergenic
1103763331 12:123266336-123266358 GAAGAAGCGGTGGCTGTGGGAGG - Intronic
1106254987 13:28014143-28014165 CAAGTAGCTAGGACCATGGGAGG - Intronic
1113104839 13:106760542-106760564 GAAGTAACGATGGCCCTGGGGGG + Intergenic
1117924986 14:60769123-60769145 GAAGTAGTCATTTCTATGGGAGG - Intronic
1129628713 15:77233990-77234012 CAAGTAGCCATGACTACAGGTGG + Intronic
1131962471 15:97804255-97804277 GAAGTGGGGATCACTGTGGGGGG - Intergenic
1140038299 16:71388205-71388227 CAAGTAGCTACGACTATAGGTGG - Intronic
1140592810 16:76373577-76373599 GAAGTAGCTATGAGTATGAAAGG + Intronic
1143369015 17:6426833-6426855 GAAGTGGCGCTGACTCTGGGGGG - Intronic
1144515552 17:15915461-15915483 AAAGAAGAGATGACTATGGCAGG - Intergenic
1145873125 17:28293072-28293094 CAAGTAGCCAGGACTATAGGTGG - Intergenic
1147379319 17:40044000-40044022 CAAGTAGCTGGGACTATGGGCGG - Intronic
1149913953 17:60591060-60591082 GGAGTAGGGATGTCTAGGGGTGG + Intergenic
1151560083 17:74865330-74865352 GAAGTAGACAGGTCTATGGGAGG + Intronic
1151682461 17:75629248-75629270 GAGGCAGCGCTCACTATGGGGGG - Exonic
1152506363 17:80751628-80751650 TAAGTGACGATGAATATGGGTGG - Intronic
1153245153 18:3066076-3066098 CAAGTAGCTGTGACTATAGGTGG + Intergenic
1157312003 18:46559841-46559863 GAAGAATTGATGACTTTGGGAGG - Intronic
1158694567 18:59692215-59692237 GATGTAGTGATGACGATGGGAGG + Intronic
1164253597 19:23507560-23507582 GAAGTAGCCATTGCGATGGGAGG - Intergenic
1167672518 19:50861658-50861680 GAAGAAGCAAGGACTGTGGGAGG + Intronic
927275809 2:21261377-21261399 GAAGTAGCCAGCACTTTGGGAGG - Intergenic
939821209 2:146959089-146959111 CAAGTAGCTAGGACTATAGGAGG - Intergenic
940224736 2:151389550-151389572 TAAGTAGCTAGGACTATAGGCGG + Intergenic
1168802827 20:653953-653975 GGAGTCGCGCTGACAATGGGTGG + Intronic
1170282635 20:14668019-14668041 CAAGTAGCTAGGACTATAGGAGG - Intronic
1175080841 20:56419130-56419152 GGAATTGCGATGACTAAGGGAGG + Intronic
1177333473 21:19693055-19693077 GAAAAAGCTATGACTATAGGAGG + Intergenic
1178641293 21:34346327-34346349 GAGGTAGCGGTGACTAGGGTGGG - Intergenic
1180086349 21:45509570-45509592 GAAGTCGCGGTGGCTGTGGGCGG - Exonic
1184486679 22:44783887-44783909 GAAGCAGCCATGACCATGGGTGG - Intronic
950557020 3:13702175-13702197 GAAGTAGCCCAGGCTATGGGTGG - Intergenic
955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG + Intronic
965208892 3:165759151-165759173 GAAGTAGGGCGGGCTATGGGTGG - Intergenic
982703937 4:158687007-158687029 GAAGTATGGATGACTTTAGGGGG + Intronic
983770714 4:171545599-171545621 CAAGTAGAGATGACTATAAGTGG + Intergenic
989220742 5:38959850-38959872 AAAGTAGTGTTGACTAAGGGTGG + Exonic
991960459 5:72039114-72039136 GAAGAAGAGGTGACTCTGGGAGG - Intergenic
1000778169 5:165444882-165444904 GAAGAAGGCATGACTATTGGAGG - Intergenic
1001582433 5:172807914-172807936 CAAGTAGCTGTGACTATGGGTGG - Intergenic
1002128776 5:177066376-177066398 GAAGTAGAGATGAATAAGGCTGG - Intronic
1006218283 6:32465209-32465231 GAAATAGGGAAGAATATGGGAGG - Intergenic
1022422840 7:30240299-30240321 AAAGGAGAGATGACTGTGGGCGG - Intergenic
1026602311 7:71786871-71786893 GAAGCAGGGATGAGTGTGGGAGG + Exonic
1026923465 7:74173289-74173311 GGAGTAGCTAGGACTATAGGCGG - Intergenic
1036451142 8:8868786-8868808 GAAGTAGCGATGACTATGGGTGG - Intronic
1040808160 8:51418813-51418835 GAAGTAGCAAATATTATGGGTGG + Intronic
1042568655 8:70138302-70138324 GAATTAGAGATGAACATGGGGGG - Exonic
1056466451 9:86860407-86860429 GATTTAGCGATGAAAATGGGTGG - Intergenic
1061964289 9:134004431-134004453 GAAGTGAAGATGGCTATGGGAGG - Intergenic
1187573468 X:20529731-20529753 GAATTAGAGATGTCTGTGGGTGG + Intergenic
1187715495 X:22098270-22098292 GAAGGAGGGAAGAGTATGGGAGG + Intronic
1187739138 X:22336417-22336439 GAGGTAGGGATGACTATGAAGGG - Intergenic
1191668608 X:63728489-63728511 AAAGTAGCAATGACAATAGGAGG + Intronic
1192046956 X:67686105-67686127 GAAGCAGGGATGACTCTGGGAGG + Exonic
1195804026 X:108742768-108742790 GTAGTAGCCAGGACAATGGGTGG - Intergenic