ID: 1036453428

View in Genome Browser
Species Human (GRCh38)
Location 8:8889405-8889427
Sequence CAATTACAAAAGATTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036453426_1036453428 -10 Left 1036453426 8:8889392-8889414 CCATTGTTCACTCCAATTACAAA 0: 1
1: 0
2: 1
3: 20
4: 270
Right 1036453428 8:8889405-8889427 CAATTACAAAAGATTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036453428 Original CRISPR CAATTACAAAAGATTTTCTC TGG Intronic
No off target data available for this crispr