ID: 1036453578

View in Genome Browser
Species Human (GRCh38)
Location 8:8890689-8890711
Sequence CTCCACATACTGATGGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036453571_1036453578 19 Left 1036453571 8:8890647-8890669 CCGAATGACATGAGCTGGCAAGA 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 123
1036453573_1036453578 -6 Left 1036453573 8:8890672-8890694 CCATGCAACAGAAAGCCCTCCAC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 123
1036453572_1036453578 -5 Left 1036453572 8:8890671-8890693 CCCATGCAACAGAAAGCCCTCCA 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036453578 Original CRISPR CTCCACATACTGATGGAGCT GGG Exonic
900232271 1:1565869-1565891 CTCCAAACACTGATGGAGTGTGG + Intronic
901964693 1:12856813-12856835 CCCCAAATACTGATGAAGTTTGG - Intronic
901980095 1:13027287-13027309 CCCCAAATACTGATGAAGTTTGG - Intronic
902001989 1:13201644-13201666 CCCCAAATACTGATGAAGTTTGG + Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
907662854 1:56409246-56409268 CCCCACCTGCTGATGGGGCTGGG - Intergenic
909995103 1:82269494-82269516 CTCCCCCTACGAATGGAGCTGGG - Intergenic
910071777 1:83224231-83224253 GTCAACATAATGAAGGAGCTGGG + Intergenic
911161239 1:94684842-94684864 CTCCAGAGACTGGTAGAGCTGGG - Intergenic
911983930 1:104598723-104598745 CTCGACATAATAAGGGAGCTGGG - Intergenic
912338625 1:108887760-108887782 CTCCACACACGGATGGGGGTAGG - Intronic
915399434 1:155611613-155611635 CTCCAGATACTGATGGATGGGGG + Intronic
915416547 1:155747193-155747215 CTCCAGATACTGATGGATGGGGG + Intergenic
916195056 1:162214958-162214980 CTCCACTCACTGATGTAGCCTGG - Intronic
920901441 1:210113780-210113802 CTCCACCTAATAAGGGAGCTGGG + Intronic
922342707 1:224670432-224670454 CTCCACAAAAGGATGGGGCTGGG - Intronic
923441466 1:234024602-234024624 CACCACATGATGAAGGAGCTGGG + Intronic
1063106319 10:2995944-2995966 CTCAACATAATAAGGGAGCTAGG + Intergenic
1063169544 10:3495220-3495242 CTCCACCTCCTAAAGGAGCTGGG + Intergenic
1067804113 10:49381504-49381526 CTCCACATATTGAGAGAGCTGGG - Intronic
1068237280 10:54254610-54254632 CTCAGCATACTGAAGGACCTTGG + Intronic
1070469817 10:76767394-76767416 CTCCACATCCTCATGGCCCTTGG - Intergenic
1071550697 10:86564206-86564228 CTCGACATAATAAGGGAGCTGGG + Intergenic
1071809879 10:89167824-89167846 TGCCACAGAATGATGGAGCTAGG - Intergenic
1075680284 10:124326336-124326358 CTCTCCATACAGGTGGAGCTAGG - Intergenic
1076338536 10:129727187-129727209 CTCCATATCCTGCTGTAGCTTGG - Intronic
1077077292 11:707395-707417 CTCCACATGCTGAGTGACCTTGG - Intronic
1081739335 11:45427188-45427210 CACCACTTACTGAGGGATCTTGG - Intergenic
1082632692 11:55560248-55560270 CTCCACCTAATAAGGGAGCTGGG - Intergenic
1082894174 11:58172603-58172625 CTCCAGAAAGTGATGGAGCCAGG + Intronic
1085320723 11:75572305-75572327 CTCCACATCCTGTGGGACCTGGG + Exonic
1092505271 12:9092304-9092326 CTCCATCTACTCCTGGAGCTAGG - Intronic
1093707221 12:22287993-22288015 CTTCAGACACTGAGGGAGCTGGG - Intronic
1094510384 12:31092862-31092884 CTCCACGTACTGCAGCAGCTGGG - Exonic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1096570016 12:52517224-52517246 CTCCTCATACTGATGCAGCCAGG + Exonic
1099111374 12:78565896-78565918 CTATACATACTGATGTAGCTTGG - Intergenic
1108827792 13:54436416-54436438 CTTCACAAACTGATAGAACTTGG + Intergenic
1110395740 13:75027965-75027987 ATCCACTGACTGATGGAGGTAGG - Intergenic
1112248797 13:97758943-97758965 ACCCACAAAGTGATGGAGCTGGG + Intergenic
1114160427 14:20159885-20159907 CTCCACCTATTGAAGGATCTTGG + Intergenic
1114475722 14:22993242-22993264 TTCCACTGACTGAGGGAGCTTGG - Intronic
1115883461 14:37945859-37945881 TCCCACACACTGATGGAGCAAGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119451151 14:74711999-74712021 CTCCAGCTACTGATCAAGCTGGG - Intronic
1122507724 14:102242356-102242378 CTCCACCTAATAAGGGAGCTGGG - Intronic
1122763965 14:104052053-104052075 CTCCACAAACTGGTTGTGCTCGG + Exonic
1124141345 15:27079938-27079960 CTCTGCATACTGAGTGAGCTGGG - Intronic
1130980892 15:88811223-88811245 CTCAAAATGCTGATGGACCTTGG + Intronic
1135020988 16:18962669-18962691 CCCCACGTACTGATGGCTCTGGG + Intergenic
1135349657 16:21718071-21718093 CTCCACCTCCTGAAGTAGCTGGG + Intronic
1136287693 16:29254009-29254031 CTCCAGACACCGATGGTGCTGGG + Intergenic
1136573965 16:31112350-31112372 CTCCACACACTGCTGCATCTTGG + Exonic
1137009826 16:35311226-35311248 ACCCACAGACTGATGGAACTGGG - Intergenic
1138143699 16:54589571-54589593 CACCACAAATTCATGGAGCTGGG + Intergenic
1138460786 16:57146528-57146550 TTCCACAAACTGATGGAACATGG + Intronic
1139219212 16:65162103-65162125 CTCCAGATATTGTTGGAGATGGG + Intergenic
1142093316 16:88226637-88226659 CTCCAGACACCGATGGTGCTGGG + Intergenic
1142199782 16:88755637-88755659 CCCCAGATACTGAAGGAGCCGGG - Intronic
1145102404 17:20088023-20088045 CTGCACATGCTCAGGGAGCTGGG + Intronic
1146406288 17:32541648-32541670 CTGCACATTCTCTTGGAGCTGGG - Intronic
1152043329 17:77919200-77919222 CTCGACCTAATAATGGAGCTGGG - Intergenic
1154055925 18:11014112-11014134 CTCCACTTGCTGTAGGAGCTAGG + Intronic
1155036634 18:22030066-22030088 ATCCACTTACTGAGGGAGCTAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160572394 18:79827176-79827198 CCCCACATGGTCATGGAGCTGGG + Intergenic
1162007943 19:7791755-7791777 CTCCACATTCTGGTCTAGCTGGG + Intergenic
925919753 2:8630833-8630855 CTCGACAGGCTGATGGAGCTGGG + Intergenic
927151730 2:20200142-20200164 CTGCACCTGCTGATGGAGCAGGG - Intergenic
929263656 2:39894563-39894585 CTCCAGATATTGACGGAGTTCGG - Intergenic
930058360 2:47269356-47269378 CTCCACATAGTGAAGGAGGCAGG - Intergenic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
935866072 2:107389022-107389044 CTCCACATTCTGGGGGAGCGGGG - Intergenic
937039623 2:118810826-118810848 CTGCACATACTTATGGCGGTGGG - Intergenic
937424763 2:121789734-121789756 CTCTACATAGTGGTGGGGCTGGG - Intergenic
1169163346 20:3401825-3401847 CTCCCCATACCGAGGTAGCTTGG - Intronic
1169163857 20:3406669-3406691 CTCCCCATACTGAGGTAGCTTGG + Intronic
1173236348 20:41249546-41249568 CTCCACAGACTGATGGGCCTGGG - Intronic
1175457344 20:59125392-59125414 CTCCCCATGCTGATGATGCTGGG - Intergenic
1177355275 21:19998832-19998854 CTCCACCTGCTGAGGGAGGTCGG - Intergenic
1178144844 21:29727547-29727569 CTCCTCATACTCATGCAGTTAGG - Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
950842159 3:15978045-15978067 GTTCACACAATGATGGAGCTTGG - Intergenic
951809089 3:26679722-26679744 CTCCACATTCTGGTGGAGGAGGG - Intronic
952303133 3:32122128-32122150 GTCCCCATCCTCATGGAGCTTGG - Intronic
952487493 3:33829379-33829401 CTACACATACTCCTGGAGCATGG - Intronic
953719627 3:45344087-45344109 ATCAACATACTGATGGTGATTGG + Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
965360232 3:167730441-167730463 CTCCACATACTGGTTATGCTAGG + Intronic
965948861 3:174279106-174279128 CCCCAGATATTGATGGAGCAAGG + Exonic
968564748 4:1305620-1305642 CACCACATGCTGGTGGAGCCGGG - Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
971589134 4:28444522-28444544 CTTCACATAGTGATGAAGATAGG - Intergenic
975574685 4:75850935-75850957 CTCGACACACTGATGTAGGTAGG + Intergenic
979068572 4:116170684-116170706 CTCAACTTTCTGATGGACCTAGG + Intergenic
979116560 4:116831477-116831499 GACCACATACTGATGCATCTTGG - Intergenic
979801504 4:124914870-124914892 CTGCATATACTGACTGAGCTTGG - Intergenic
985491001 5:179446-179468 CCCCACATACTGAAGGACCTGGG + Intronic
986663272 5:10077723-10077745 CTCAAAATACTGATAGTGCTAGG - Intergenic
986859292 5:11906463-11906485 CTACAGATACTGTTGGGGCTGGG + Intergenic
987220966 5:15790078-15790100 CTCCCCAAACTCATGAAGCTAGG + Intronic
987260174 5:16195250-16195272 ATCCACAGACTGATGTTGCTTGG - Intergenic
995436032 5:112136348-112136370 CAGCACATACTGTAGGAGCTAGG - Intergenic
999134422 5:149308709-149308731 CTCCACATATTGCAGTAGCTAGG + Intronic
1002085404 5:176771885-176771907 CTCCTCACTCTCATGGAGCTGGG + Intergenic
1002213071 5:177609771-177609793 CTCCACATCCTGTCAGAGCTGGG - Exonic
1005421237 6:25653423-25653445 CTCCACATGTTGATGAAACTGGG + Exonic
1007084602 6:39134568-39134590 CTCCACCTAATAAGGGAGCTGGG + Intergenic
1011821873 6:91262442-91262464 ATGCACACACTGATGGAGCTGGG + Intergenic
1015521872 6:134139684-134139706 CTCCACACCCTGATGTAGCTGGG - Intergenic
1015690828 6:135920858-135920880 CAGCACTTACTGATGAAGCTAGG - Intronic
1021973671 7:25990031-25990053 CCCCTTATACCGATGGAGCTGGG - Intergenic
1022044173 7:26610271-26610293 CTCGACACAGTGACGGAGCTGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027289485 7:76689182-76689204 GTCAACATAATGAAGGAGCTGGG + Intergenic
1035289427 7:157828105-157828127 CCCCACATGCAGATGGAGCTGGG + Intronic
1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG + Exonic
1037300006 8:17441779-17441801 TTCCACATACTGACGGAGAAAGG + Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1040550572 8:48434263-48434285 CCCCACACACTGATGTGGCTGGG - Intergenic
1043027716 8:75091628-75091650 TTCCACATCCTGCTGTAGCTGGG + Intergenic
1048861592 8:138727919-138727941 CTCCACAGACTGCTCCAGCTTGG + Intronic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1053387018 9:37700499-37700521 CTCCACATCCTGCTGGAACTCGG + Intronic
1056749544 9:89337756-89337778 CTCCCCATTCTGATGGAGGGAGG + Intronic
1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG + Intronic
1057406073 9:94771803-94771825 CTCCTCATATTGGAGGAGCTGGG - Intronic
1057829507 9:98395942-98395964 CTCCACACACTGTTTTAGCTAGG - Intronic
1186078255 X:5903599-5903621 CCCCAGATCCTGATGGAGCAAGG - Exonic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1193276786 X:79598240-79598262 CTCCACCTACAAATGGAGCCTGG - Intergenic
1193397883 X:81006943-81006965 CTCCACTTTTTGATGGGGCTGGG + Intergenic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1198581160 X:138066276-138066298 CTGCCCAGAATGATGGAGCTGGG - Intergenic
1201517088 Y:14829975-14829997 CCCCAGATCCTGATGGAGCAAGG + Exonic
1201694146 Y:16806387-16806409 TTCCACTTATTGATGGAGGTGGG - Intergenic