ID: 1036453633

View in Genome Browser
Species Human (GRCh38)
Location 8:8890967-8890989
Sequence CCTGCAGGCGGGTCTGACCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036453633_1036453648 30 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453648 8:8891020-8891042 CACAGTCGCTGGGCCTGAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 193
1036453633_1036453645 20 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453645 8:8891010-8891032 CCAGCTTAGCCACAGTCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1036453633_1036453643 19 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453643 8:8891009-8891031 ACCAGCTTAGCCACAGTCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1036453633_1036453646 27 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453646 8:8891017-8891039 AGCCACAGTCGCTGGGCCTGAGG 0: 1
1: 1
2: 3
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036453633 Original CRISPR CCTGCAGGCGGGTCTGACCG AGG (reversed) Exonic
900109372 1:999127-999149 GCTGCTGCCGGGTCTGACCCGGG - Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900564821 1:3327050-3327072 CCTGCAGGCTGGGCTGACCGAGG - Intronic
901644376 1:10708849-10708871 CCTGCAGGCGGCTCGGAGTGGGG + Intronic
902896705 1:19484917-19484939 GCTGCAGAAGGGGCTGACCGGGG + Intronic
903068298 1:20713604-20713626 CCTGCTGCCAGGTCTGACCCTGG + Intronic
903668050 1:25019709-25019731 CCTGCATGCGGGTCTGGCCCCGG - Intergenic
924802865 1:247340270-247340292 CCTGTATGTGGGTCTGACAGAGG - Intergenic
1064145954 10:12826629-12826651 CCTGCAGCCTGGTCTCACCCTGG + Intronic
1075723303 10:124599482-124599504 CCTGGAGGCGGGACTGGCAGAGG - Intronic
1076401607 10:130188978-130189000 CCTGAAGGCAGGTCTGACGCGGG + Intergenic
1076439066 10:130467175-130467197 CCTGAAGGCAAGTCTGACCAAGG - Intergenic
1076744788 10:132507421-132507443 CCTGCAGGCAGGTGTGGCCCTGG - Intergenic
1077606552 11:3616425-3616447 TCCTCAGGTGGGTCTGACCGGGG - Intergenic
1077903606 11:6511342-6511364 CCTGCAGACGGCTCTAGCCGAGG + Exonic
1081989631 11:47330804-47330826 CCTCCAGGCGGTTGTGACCACGG + Intergenic
1082050454 11:47766922-47766944 CCTGCAGGCGGGGCGGCCCTGGG - Intronic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1088648417 11:111936894-111936916 CTTGCAGGCGGGTGTGCCCGTGG - Intronic
1089337210 11:117733535-117733557 CTTGCAGGAGGGTGTGACTGTGG - Intronic
1090644679 11:128758108-128758130 CCTGCAGGAGGCTCTGTCGGTGG + Exonic
1091219689 11:133922701-133922723 CCCGCAGCCGGACCTGACCGAGG - Exonic
1095875739 12:47078940-47078962 CCTGCAGCCCGGTCTGACGACGG + Exonic
1100631971 12:96399365-96399387 CCTGCTGGCGGGTCACACCCCGG - Intronic
1102375602 12:112418966-112418988 CCTGGAGGGGGGTCTGTGCGCGG + Exonic
1102597178 12:114001773-114001795 CCTGCATGGGGCTCTGACCTGGG + Intergenic
1103395086 12:120601062-120601084 CCTGCAGGCGGCCCTGGCAGAGG - Intergenic
1106902259 13:34366465-34366487 CCTGAAGGCCGGTCTGGCCCAGG - Intergenic
1113796254 13:113060502-113060524 CCTGCACGCTGGGCTGACCGGGG - Intronic
1119414991 14:74464037-74464059 CCAGCAATGGGGTCTGACCGTGG + Intergenic
1119758272 14:77133820-77133842 CCTGGTGGCGGGTCTGCCCGCGG + Exonic
1121020315 14:90575953-90575975 CCAGCAGGCGGGGCTCACCATGG + Intronic
1121336863 14:93082893-93082915 ACTGCGGCCGGGTCTGGCCGGGG - Intronic
1122321296 14:100857557-100857579 CCTGCAGGCTGCTCTGCCAGTGG - Intergenic
1123990648 15:25680792-25680814 CATGCAGGCGGCTCTTACCCAGG + Exonic
1128944559 15:71811844-71811866 CCTGCAGGCGGGGATGAACCAGG + Exonic
1129257651 15:74343174-74343196 CCTGCAGGCGGGTGGGAAGGAGG + Intronic
1133633312 16:7642449-7642471 CCTTCAGAGGGGTCTGACGGTGG - Intronic
1134806630 16:17131500-17131522 CCTGCAGGGTGGGCTGACCATGG - Intronic
1134835108 16:17354803-17354825 CCTGCAGGCAGGTCAGACAAGGG - Intronic
1136282194 16:29220483-29220505 CCAGCAGGCCAGGCTGACCGGGG + Intergenic
1139433775 16:66925020-66925042 CCTGCAGGCGGCGCTGACCCCGG - Exonic
1142133765 16:88442504-88442526 CCTGCAGGCAGGCCTGGCCCAGG - Intergenic
1142212897 16:88816759-88816781 GCTGCAGCCGGGTCTGGCCCTGG + Intronic
1142920929 17:3184965-3184987 CCTGCAGGCTGGTGTGGCCAGGG - Intergenic
1143724360 17:8835308-8835330 CCTGCAGGCGGCTCTGGGGGAGG - Exonic
1151396696 17:73827568-73827590 CCTCCAGCTGGGTCTGACCCAGG + Intergenic
1152363825 17:79844194-79844216 CCTGCAGCCTGGCCTGGCCGCGG + Intergenic
1157818552 18:50748963-50748985 CCTCCAGGCTGGGCTGACCCTGG - Intergenic
1162125230 19:8496027-8496049 CCTGCAGGCAGGTGTGGCAGTGG - Intronic
1162176414 19:8832982-8833004 CCTGGGGGCGGGGCTGACTGTGG + Intronic
1166788935 19:45386081-45386103 CCTGGACGCGGCGCTGACCGGGG - Exonic
1166978149 19:46617161-46617183 CCTGCAGGGGGGTGGGAGCGCGG + Intergenic
1167509911 19:49890600-49890622 CCTGCAGGCGGGGCGGGGCGGGG + Exonic
1168403477 19:56099048-56099070 CCTGCAGGCGGGACAGATCCAGG - Intronic
925599050 2:5589386-5589408 CCTGCAGGGGGTGCTGAGCGAGG + Intergenic
927533876 2:23836975-23836997 CCTGAAGGTGGGTCTCACCACGG + Intronic
940883996 2:158973052-158973074 CCTGCAGGTGGGTGTGATCAAGG + Intronic
940909399 2:159196748-159196770 CCTGCAGCAGGCGCTGACCGCGG + Exonic
942043502 2:172085962-172085984 CCTCCAGGCGGCTCTGGGCGAGG - Exonic
948628093 2:239283095-239283117 CCTGCATGCGTGGCTGACTGTGG - Intronic
948727749 2:239945158-239945180 CCCGCAGGAGGGCCTGACTGGGG + Intronic
948883672 2:240872707-240872729 CCTGCAGCTGGGTCTCACCAGGG + Intronic
948919115 2:241053066-241053088 CCTGCAGTCGGGTCGGGCAGAGG + Intronic
1169214466 20:3785394-3785416 CCTGCAGCTGGGTCTCACGGAGG - Exonic
1172444150 20:34984525-34984547 GCTGCAGGAGGGTCAGGCCGAGG + Intronic
1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG + Intronic
1182095663 22:27623573-27623595 ACTGCATGCGGGTCTCATCGCGG - Intergenic
1183713415 22:39520001-39520023 CCAGCAGGCGGGGCTGGCTGAGG + Intronic
1185349602 22:50327507-50327529 CCTGGGGTCGTGTCTGACCGCGG + Intergenic
1185402267 22:50625327-50625349 CCTGCTGGGGGGTGTGGCCGGGG - Exonic
952303198 3:32122702-32122724 CCTCCAGGTGGGTCTTACCTGGG - Intronic
955078673 3:55637511-55637533 CATCCAGGCTGGGCTGACCGGGG + Intronic
965261338 3:166489641-166489663 CCTGAAGGTGGGCCTCACCGGGG - Intergenic
966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG + Intronic
968457633 4:707120-707142 CATCCAGGAGGGTCTGACCCTGG + Intronic
968950474 4:3688795-3688817 CCTTCAGGGAGGTCTGACTGTGG - Intergenic
968974017 4:3811748-3811770 CCTGCAGGCGAGTCAGGCCTGGG - Intergenic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
985574278 5:666335-666357 CCTGCAGGCCGCTCTGACACAGG + Intronic
986372179 5:7090970-7090992 GCAGCAGGTGGGTCTGACCTGGG + Intergenic
987160743 5:15139809-15139831 CCTGGAGGAAGGTCTGACCTGGG - Intergenic
992668224 5:79032647-79032669 CCTGCCTGTGGTTCTGACCGAGG - Intronic
1002090413 5:176802370-176802392 CCTGAAGAGGGGTCTGACCTCGG + Intergenic
1002175785 5:177400378-177400400 CCTGCAGGCGGGCCTGAGCGTGG - Exonic
1002399976 5:178986292-178986314 CCTGCGGGCGGCACAGACCGCGG + Exonic
1003162404 6:3647203-3647225 CCTGAAGGCGGGAGTGGCCGGGG - Intergenic
1007637691 6:43309003-43309025 CCTCCCCGTGGGTCTGACCGAGG - Intronic
1008631046 6:53363408-53363430 CCGGCAGGCAGCTCTGCCCGTGG - Intergenic
1014612445 6:123561397-123561419 CATTCAGGCGGGTCTGTCCTCGG + Intronic
1015200780 6:130577754-130577776 CCTGGTGGCTGGCCTGACCGAGG - Intergenic
1018232781 6:161691320-161691342 CCTGCAGGCAGCTCTCACCCGGG + Intronic
1019523621 7:1471212-1471234 GCTGCAGGTTGGTCTGACCGGGG + Exonic
1020700421 7:11475050-11475072 CATGCAGGCAGGTGTGACCTTGG + Intronic
1024317672 7:48036140-48036162 CCTGCAGGCGTGTCAGGGCGAGG + Intronic
1024903804 7:54353050-54353072 CCTGCAGGCAGGACTTACCCTGG - Intergenic
1025263714 7:57439310-57439332 CCAGCAGGCTGGGCTGGCCGTGG + Intergenic
1025635518 7:63316804-63316826 CCAGCAGGCTGGCCTGGCCGTGG - Intergenic
1025647177 7:63431366-63431388 CCAGCAGGCTGGCCTGGCCGTGG + Intergenic
1027785256 7:82572555-82572577 CCAGCAGGAGAGTCTGACCCAGG + Intergenic
1029672035 7:102039974-102039996 CCTGCATGCAGCTCTGAACGTGG - Intronic
1035117321 7:156535617-156535639 CCTGCAGGTGGGTTAGACTGAGG - Intergenic
1035270825 7:157719007-157719029 CCTGCAGGCGTCTCTGGCCCTGG + Intronic
1035473694 7:159128040-159128062 CTTGCAGCAGGGCCTGACCGTGG + Intronic
1035872756 8:3153688-3153710 CCTGCAGGAGGGGCTGGCCCAGG + Intronic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1048292431 8:133191209-133191231 CCTCCAGGCAGGACTCACCGTGG - Exonic
1049687328 8:143944197-143944219 CCTCCCGGCGGGTGTGGCCGCGG - Intronic
1055554264 9:77459615-77459637 CCTGCAAGTGGGACTGACAGTGG - Intronic
1060139836 9:121201065-121201087 CCTGCAGCCGGGCCGGGCCGGGG - Intronic
1061449912 9:130662351-130662373 CCTGCAGGGGAGCCTCACCGGGG - Intergenic
1061507495 9:131039650-131039672 CCTGCATGGGGGTTTGACTGTGG + Intronic
1061840500 9:133356297-133356319 CCTCCAGGCGGCGCTGGCCGGGG + Exonic