ID: 1036453633

View in Genome Browser
Species Human (GRCh38)
Location 8:8890967-8890989
Sequence CCTGCAGGCGGGTCTGACCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036453633_1036453648 30 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453648 8:8891020-8891042 CACAGTCGCTGGGCCTGAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 193
1036453633_1036453645 20 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453645 8:8891010-8891032 CCAGCTTAGCCACAGTCGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1036453633_1036453643 19 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453643 8:8891009-8891031 ACCAGCTTAGCCACAGTCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1036453633_1036453646 27 Left 1036453633 8:8890967-8890989 CCTCGGTCAGACCCGCCTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1036453646 8:8891017-8891039 AGCCACAGTCGCTGGGCCTGAGG 0: 1
1: 1
2: 3
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036453633 Original CRISPR CCTGCAGGCGGGTCTGACCG AGG (reversed) Exonic