ID: 1036453957

View in Genome Browser
Species Human (GRCh38)
Location 8:8892533-8892555
Sequence AGTCAGGCAGGTGCGCCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036453947_1036453957 16 Left 1036453947 8:8892494-8892516 CCACGTCCAGGGTGCGCAGGCGG 0: 1
1: 0
2: 4
3: 6
4: 83
Right 1036453957 8:8892533-8892555 AGTCAGGCAGGTGCGCCAGCCGG 0: 1
1: 0
2: 1
3: 13
4: 209
1036453950_1036453957 10 Left 1036453950 8:8892500-8892522 CCAGGGTGCGCAGGCGGGAGAGG 0: 1
1: 1
2: 0
3: 27
4: 327
Right 1036453957 8:8892533-8892555 AGTCAGGCAGGTGCGCCAGCCGG 0: 1
1: 0
2: 1
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036453957 Original CRISPR AGTCAGGCAGGTGCGCCAGC CGG Exonic
901642471 1:10699584-10699606 AGGCAGCCAGGAGTGCCAGCAGG + Intronic
902230184 1:15022788-15022810 AGTCAGACAGGTGCATGAGCGGG - Intronic
902341192 1:15784696-15784718 AGTCAGGGAAGGGCCCCAGCCGG - Intronic
902769138 1:18635552-18635574 AGGCAGGCAGGTGGGCAGGCAGG + Intronic
903219019 1:21858676-21858698 AGTCAGGCAGGTGGGCACGGGGG - Intronic
903271119 1:22188926-22188948 AGCCAGGAAGGTGAGACAGCAGG + Intergenic
903929348 1:26853476-26853498 AGCCAGACAGGTGGGCCAGTTGG + Intronic
904062957 1:27725759-27725781 AGTCACGCGGGGGCGCCACCTGG - Intergenic
905784043 1:40738274-40738296 ACTCAGGAAGGTGAGCCAGGAGG - Intronic
907338363 1:53715641-53715663 ACTGAGGCAGGGACGCCAGCAGG + Intronic
908403910 1:63795139-63795161 AGCCAGGCTGGTGCTCCAGAGGG + Intronic
909336900 1:74485715-74485737 AGTCAGGCATGTGCCCTTGCCGG + Intronic
909892045 1:81019734-81019756 AGTCACGCAGGTCAGCCATCTGG - Intergenic
910630059 1:89344914-89344936 AGTCAGGCAGGTGCAGGAGCTGG - Intergenic
917141778 1:171842031-171842053 AGGCAGGCAGGAGGGCCACCAGG - Intronic
921180828 1:212630069-212630091 AGGCAGCCAGGTGCGGCTGCGGG + Intergenic
922986540 1:229870290-229870312 AGTCAGGCAGGAGACCCAGAGGG + Intergenic
1062818669 10:518242-518264 AGTCAGGCAGCAGGGGCAGCAGG - Intronic
1062929759 10:1345045-1345067 AGCCTGGCAGGTGAGCCAGGAGG + Intronic
1070144621 10:73764785-73764807 AGCCAGGCAGCTGCTCCACCAGG + Intronic
1070167827 10:73911564-73911586 AGAGAAGCAGGCGCGCCAGCAGG - Exonic
1070453211 10:76582528-76582550 ATTCAGGCAGGTCCCCCAGAAGG - Intergenic
1070673729 10:78397526-78397548 AGCCAGGCAGGAGCAACAGCAGG + Intergenic
1071274860 10:84044379-84044401 CGTCATGCAGGTGTGCCAGCAGG - Intergenic
1073177364 10:101564678-101564700 AGGCAGGCAGGTGGGCAGGCGGG + Intergenic
1073288109 10:102400463-102400485 AGTCAGGCATATGCAACAGCTGG - Exonic
1077444283 11:2583115-2583137 AGGCAGGCAGATGAGGCAGCCGG + Intronic
1079116790 11:17645324-17645346 AGTGAGGCAGGAAGGCCAGCAGG - Intronic
1081312759 11:41593712-41593734 AGACAGGCAGGTGCAGGAGCTGG + Intergenic
1081763339 11:45592322-45592344 AGACAGGCAGGTGAGCAAGCAGG - Intergenic
1081834629 11:46143636-46143658 AGTCAGGAAAGGGCCCCAGCCGG - Intergenic
1081907933 11:46680989-46681011 AGTGAGGCGGGTGCGGCGGCTGG - Exonic
1082961993 11:58927398-58927420 AGTCAGGCAGGTGCGTCCTGGGG + Intronic
1083366909 11:62146911-62146933 AGGCAGGCAGGCGGGCCAGCAGG - Intronic
1084172952 11:67409457-67409479 AATCGGGCAGCTGGGCCAGCTGG - Exonic
1084272332 11:68036045-68036067 AGCAAGGCAGGGACGCCAGCAGG + Intronic
1089176720 11:116553824-116553846 AGTCAGGTAGGGGGGCCTGCGGG + Intergenic
1090251871 11:125257261-125257283 CGACAAGCAGGTGAGCCAGCCGG - Intronic
1091798063 12:3308606-3308628 AGTCAGGCAGTGGCTGCAGCGGG - Intergenic
1092744697 12:11662285-11662307 AGAAAGGTAGGTGAGCCAGCAGG + Intronic
1092754700 12:11752563-11752585 ACTCACGCAGGTGCGCAGGCAGG - Exonic
1093749195 12:22779279-22779301 AGACAGGCAGGTGCGTGAGCTGG + Intergenic
1095699891 12:45180361-45180383 AGTCTTGCTGGTGCCCCAGCTGG + Intergenic
1095706553 12:45243208-45243230 ACTCAGGCAGCTGAGGCAGCAGG + Intronic
1098314819 12:69182198-69182220 AGACATGCAGGTGCGGGAGCCGG + Intergenic
1099943412 12:89217407-89217429 AGGCAGGCAGGTGGGCAGGCAGG + Intergenic
1100064429 12:90624435-90624457 ATTCAGGCAGGTCCTCCAGGAGG + Intergenic
1100391067 12:94147197-94147219 AGTCTGGCAGATGAGCCAGGGGG - Intergenic
1101342750 12:103857761-103857783 AGTCAGGCAGATGTGGCAGTGGG + Intergenic
1104372335 12:128234962-128234984 AGTCAGGCAGTGGCTCCAGCTGG + Intergenic
1104640014 12:130461322-130461344 AGACTGGCAGGGGTGCCAGCAGG + Intronic
1104837410 12:131800460-131800482 GGTGAGGCAGGTGGGCAAGCTGG + Intergenic
1106507398 13:30383093-30383115 AGTCAGGCAGGCGGGGCACCAGG + Intergenic
1110003749 13:70238892-70238914 AGACAGGCAGGTGCAGGAGCTGG - Intergenic
1110933020 13:81246890-81246912 GGGCAGGCAGGTGCGGCTGCTGG + Intergenic
1111162989 13:84420087-84420109 AGTCAGGAAGGTGGGACAGGAGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1117390403 14:55256825-55256847 AGACAGGCAGGTGCAGGAGCTGG - Intergenic
1118480571 14:66161056-66161078 AGGTAGGCAGGTGCACCTGCAGG + Intergenic
1119023758 14:71136647-71136669 AGACAGGCAGGTGCAGGAGCTGG + Intergenic
1121178202 14:91906739-91906761 GGTCTGGCAGGTCAGCCAGCTGG - Intronic
1121471499 14:94158397-94158419 AGTCAGGAAGGAGCATCAGCAGG + Intronic
1122270373 14:100566293-100566315 AGGTAGGCAGGTGTGCCAGGTGG - Intronic
1123771888 15:23537318-23537340 ACACAGGCAGGAGAGCCAGCTGG - Intergenic
1128322859 15:66704909-66704931 AGACAGGCAGAGGCCCCAGCAGG + Intronic
1129232077 15:74202566-74202588 GGTCAGACAGATGCGCCAGCGGG - Exonic
1129985841 15:79919302-79919324 AGGCAGCCAGGCGCGCCAGAGGG - Intronic
1131434443 15:92411989-92412011 AGACAGGCAGGTGCTCCCGGTGG + Intronic
1131507444 15:93030514-93030536 AGGAAGGCACGTGGGCCAGCGGG + Intergenic
1132251943 15:100341227-100341249 AGGCCGGCAGGTGCAGCAGCAGG + Exonic
1132808785 16:1787894-1787916 GGTCAGCCAGGCGCACCAGCAGG - Intronic
1133022937 16:2974765-2974787 AGTCAGGGAGGGGCGGAAGCAGG + Intronic
1133384002 16:5354158-5354180 AGCCAGGCAGGTGCACTTGCGGG + Intergenic
1133981618 16:10636963-10636985 AATCAGCCAGGTGAGGCAGCAGG - Intronic
1134303168 16:13009348-13009370 ATTCAGGAAGGTGGGTCAGCCGG + Intronic
1134873621 16:17675867-17675889 AGACAGGCAGGTGCAGGAGCTGG + Intergenic
1136621955 16:31435581-31435603 ATTTAGGCAGGTGCGGCTGCGGG - Exonic
1139451115 16:67028964-67028986 AGCCAGGCCGCTCCGCCAGCGGG + Intergenic
1141657275 16:85422900-85422922 AGCCAGGCAGGTGAGCAAGCGGG - Intergenic
1142126098 16:88411430-88411452 AGGCAGGCAGGTGAGCAGGCAGG + Intergenic
1142155702 16:88532054-88532076 AGTAGAGCAGGTGCGCCTGCAGG - Exonic
1142814258 17:2412867-2412889 AGCCAGCCAAGTGCCCCAGCTGG + Intronic
1144733220 17:17540520-17540542 AGTGAGTCAGGAGCACCAGCTGG + Intronic
1145045740 17:19614192-19614214 AGTCAGGGAGATGCGCCACAGGG - Intergenic
1150270422 17:63860819-63860841 AGCCAGGCAGGCTCCCCAGCAGG - Intergenic
1150521632 17:65873208-65873230 AGTCAGGCAGGTGAGCCCGATGG - Intronic
1151921090 17:77156097-77156119 AGTCAGCCAGGTGAGAAAGCAGG - Intronic
1154979380 18:21489964-21489986 ACTCAGGCAGCAGGGCCAGCTGG - Intronic
1155027537 18:21956214-21956236 AGTCCTGCATGTGCGCCACCTGG + Intergenic
1155071405 18:22320147-22320169 AGTGAGGCAGGTGAGCCTGTTGG + Intergenic
1155394954 18:25377241-25377263 AGACAGGCAGGTGCAGGAGCTGG - Intergenic
1160335545 18:78035552-78035574 AATCAGGAAGGTGCTCCTGCAGG + Intergenic
1162178124 19:8846970-8846992 AGACAGGCAGGTGCAGGAGCCGG + Intergenic
1162958764 19:14114058-14114080 AGTCAGGGAGGGGCTGCAGCGGG - Intronic
1167436518 19:49481555-49481577 AGGTAGGCAGGTGGGCCAGGAGG + Intronic
1167529013 19:50003196-50003218 AGTCAGTCAGGGTCCCCAGCAGG - Intronic
925265473 2:2563623-2563645 AGTGAGGCAGGTGAGACAGGTGG + Intergenic
925772938 2:7301107-7301129 AGGCAGGCAGAGGCACCAGCTGG - Intergenic
926056854 2:9778802-9778824 AGCCAGGCAGGGGCTTCAGCGGG - Intergenic
929147406 2:38718823-38718845 AGTCAGGCATGAGGGCCACCAGG + Intronic
932106129 2:68944277-68944299 TGGCAGGCAGGTGGGCCTGCGGG + Intergenic
936460352 2:112709832-112709854 AGTCAAGCTGGTGTGACAGCTGG + Intergenic
937445319 2:121952621-121952643 TGGCAGGCAGGTGCGACAGATGG - Intergenic
942066519 2:172276883-172276905 AGTCAGGCTTGTAGGCCAGCAGG + Intergenic
942451163 2:176108558-176108580 AGTCAAGCAGATGCCCCGGCGGG + Intronic
943371491 2:187022388-187022410 AGTGAGGCAGCTGGCCCAGCTGG + Intergenic
943749143 2:191493799-191493821 AGACAGGCAGGTGCAGAAGCTGG + Intergenic
946253716 2:218429054-218429076 TGTCAGGGAGGTGCTCAAGCGGG - Intronic
946389870 2:219408885-219408907 GGTCAAGCAGCTGCTCCAGCTGG + Intergenic
948704388 2:239779928-239779950 AGTCAGGCAGGTGATGGAGCTGG - Intronic
948729846 2:239955965-239955987 AGGGAGGCAGGGGCGACAGCAGG + Intronic
1168978203 20:1983673-1983695 AGGCAGGCAGGGAGGCCAGCAGG - Intronic
1169003073 20:2182292-2182314 AGTCAGGCAGGTCCGGGTGCAGG + Intergenic
1172169181 20:32918553-32918575 AGACAGGCCTGTGCCCCAGCAGG + Intronic
1172173997 20:32961386-32961408 CGTCAGGAAGGTGGGCAAGCTGG - Intergenic
1172785307 20:37464676-37464698 AGGCAGGCAGGTGAGCCTGTGGG - Intergenic
1173363893 20:42368120-42368142 AGTCAGGCAGCTGAACCAGAAGG - Intronic
1173701439 20:45075296-45075318 ACTCAGGAATGTGCGCCAGTGGG + Exonic
1175791864 20:61744981-61745003 AGGCAGGCAGCTGCAACAGCTGG - Intronic
1176170708 20:63695218-63695240 AGCCAGGCAGGTGCCCTACCTGG - Exonic
1179172798 21:38985736-38985758 AGTCAGTCACGAGAGCCAGCCGG - Intergenic
1179266143 21:39805432-39805454 TGACAGGCAGGTGGTCCAGCAGG + Intergenic
1179898966 21:44379074-44379096 AGACAGGCAGGTTGGCCACCTGG - Exonic
1179937593 21:44615022-44615044 TGGCAGGCAGGAGCTCCAGCTGG + Intronic
1180048445 21:45320508-45320530 TGGCAGACAGGTGGGCCAGCGGG + Intergenic
1181479950 22:23192445-23192467 AGTCAGGCAGGCCTTCCAGCAGG + Intronic
1181782498 22:25203210-25203232 AGGCAGGCAGGTCTCCCAGCTGG + Intronic
1182872350 22:33659112-33659134 AGTCAGGCAGCTGGGCTAGAAGG - Intronic
1183157272 22:36085126-36085148 AGACAGGCAGGTGTCCCTGCTGG - Intergenic
1183467413 22:37986683-37986705 GGTGAGGCAGGTGGGCCTGCAGG + Intronic
1184393455 22:44218895-44218917 AGTTAGCCAGGTGTGGCAGCAGG - Intronic
949920523 3:8996718-8996740 AGGCAGGCAGATGGGCTAGCAGG - Intronic
950080219 3:10216595-10216617 AGTCAGGCAGGTGTGGGATCTGG + Intronic
950390618 3:12693806-12693828 AGTCAGGCAGGAGCTCCAGCTGG - Intergenic
951531142 3:23699094-23699116 ATTCACACAGGTGTGCCAGCAGG - Intergenic
951752534 3:26053600-26053622 AGTCAGGCAGGCAGGCAAGCAGG + Intergenic
953292804 3:41683425-41683447 AGGGAGGCATGTGAGCCAGCAGG + Intronic
953594231 3:44293327-44293349 ATTCAGGCAGGTCCTCCAGAAGG + Intronic
953698373 3:45177593-45177615 AATCAGCCAGGTGTGGCAGCGGG + Intergenic
954149199 3:48648778-48648800 AGGCCAGCAGGTGGGCCAGCAGG + Exonic
955080033 3:55649923-55649945 AGACATGCAGGTGGGCCAGGAGG + Intronic
955473675 3:59313441-59313463 AGTGAGGCAGGTGAGCCATTGGG - Intergenic
956679872 3:71768588-71768610 ACTCATGCAGTTGTGCCAGCTGG - Intergenic
959550020 3:107643673-107643695 AGAAAGGCAGGTGGGCCAGCAGG - Intronic
960055067 3:113271165-113271187 CATCAGGCAGGTGTGGCAGCAGG - Intronic
960359747 3:116697336-116697358 AGGCAGGCAGGTGCAGGAGCTGG + Intronic
960995933 3:123340141-123340163 AATCAGCCAGGTGTGGCAGCAGG + Intronic
961286893 3:125813137-125813159 AGGCGGGCAGGTGCGCCACTGGG + Intergenic
961402614 3:126657784-126657806 AGTCAGGAAGGAGCCCAAGCTGG + Intergenic
962316098 3:134360391-134360413 AGACAGGCAGGTGCCCCAGGTGG - Exonic
968089297 3:195890147-195890169 GGCCAGGCAGCTGGGCCAGCCGG + Intronic
968154826 3:196371628-196371650 AATCAGCCAGGTGTGGCAGCAGG - Intronic
968902699 4:3438922-3438944 AGCGAGGCAGGTGGGCGAGCAGG + Intronic
968916385 4:3498697-3498719 AGGCAGGCACCTGGGCCAGCAGG - Intronic
972456862 4:39263540-39263562 AGGCAGACAGGAGAGCCAGCAGG - Intronic
972928910 4:44047264-44047286 AGCCAGGAAGGTGCACCACCAGG + Intergenic
973377465 4:49297231-49297253 TGTCAGCCACGTGGGCCAGCAGG + Intergenic
973378383 4:49303367-49303389 TGTCAGCCACGTGGGCCAGCAGG + Intergenic
973380677 4:49318136-49318158 TGTCAGCCACGTGGGCCAGCAGG - Intergenic
974069707 4:57112364-57112386 GGGCAGGCAGGTGAGCAAGCAGG + Intergenic
975227592 4:71892159-71892181 AATCAGGCAGGTGCCCCACTGGG + Intergenic
975683600 4:76898283-76898305 AGTCAGGCCGGAGAGCCAGCCGG + Intergenic
975708326 4:77133715-77133737 AGGCAGGCAGGTGGGCAGGCGGG - Intergenic
976823545 4:89234305-89234327 AGTCAGAGAGATGCTCCAGCTGG - Intergenic
979601003 4:122586469-122586491 AGACAGGCAGGTGCAGGAGCTGG - Intergenic
982758342 4:159251106-159251128 GGGCAGGCAGGCGGGCCAGCTGG - Intronic
987151295 5:15043132-15043154 ACTCAGGCAGGTCCTTCAGCAGG - Intergenic
994351214 5:98748619-98748641 TGTCAGGCATGGGGGCCAGCGGG + Intergenic
997592785 5:135086064-135086086 AGACAGGAAGGTTCTCCAGCCGG - Intronic
997812717 5:136987863-136987885 AGTCAGACAGGTTGGCCTGCTGG - Intronic
998029175 5:138849591-138849613 AGTGAGGCACGTGCGCTGGCTGG + Intronic
999101267 5:149027919-149027941 GGTCAGGCAGGCAGGCCAGCAGG + Exonic
999266561 5:150270527-150270549 AGTCACCCAGGAGCACCAGCAGG + Intronic
999851503 5:155544841-155544863 AATTAGGCAGGTGTGGCAGCGGG + Intergenic
1001454280 5:171848717-171848739 AGCCAGGCAGGTAAGCCAGGAGG + Intergenic
1001954091 5:175836530-175836552 TCTCAGGCAGGTTCTCCAGCGGG + Intronic
1002596731 5:180328595-180328617 AGCCCGGCAGGGGTGCCAGCTGG + Intronic
1002693144 5:181065078-181065100 AGGCAGCCAGGGGCCCCAGCTGG + Intergenic
1003064511 6:2891853-2891875 CGTCAGGCAGCAGCACCAGCAGG + Exonic
1005302078 6:24480984-24481006 AGTAAGGCAGGTGCCCGAGGTGG + Intronic
1010557541 6:77302478-77302500 AGTCAGGCAAGAGCAGCAGCTGG - Intergenic
1011530248 6:88312966-88312988 AGTCTGGCAGGTAAACCAGCTGG - Intergenic
1015086008 6:129292940-129292962 CGGCAGGCAGGTGCACCAACAGG + Intronic
1015965444 6:138692617-138692639 GGTCGGCCAGCTGCGCCAGCAGG + Intergenic
1017789105 6:157780112-157780134 AGCCAGGCAGGAGAGCCAGGCGG - Intronic
1018154968 6:160977236-160977258 AATCAGTCGGGTGGGCCAGCAGG - Intergenic
1018748542 6:166781518-166781540 AGTCAGGCAGGTTCACCTGGTGG + Intronic
1019170957 6:170132958-170132980 ATTCAGGCAGGTGCCTCAGTGGG + Intergenic
1019170992 6:170133128-170133150 AGACAGGCAGGTGCTTCAGTGGG + Intergenic
1019171002 6:170133185-170133207 AGACAGGCAGGTGCCTCAGTGGG + Intergenic
1019171025 6:170133299-170133321 AGGCAGGCAGGTGCCTCAGTGGG + Intergenic
1019646109 7:2129863-2129885 AGGCAGGCAGCTGGGTCAGCAGG + Intronic
1020123560 7:5519605-5519627 AGTCAGCCAGGCGCTCCAGGGGG - Intergenic
1022631689 7:32091534-32091556 AGTCAGGAAGGGGCAACAGCCGG + Intronic
1023960416 7:44921826-44921848 AGTGAGGGAGGTGCCCCAGTGGG + Intergenic
1029609039 7:101616845-101616867 AGTGGGGCAGGTGGGCCAACAGG + Intronic
1030166780 7:106563062-106563084 AGGCAGGCAGGCAGGCCAGCCGG + Intergenic
1030320959 7:108166854-108166876 AGGCCGCCAGGTGCTCCAGCTGG - Intronic
1033390478 7:140923833-140923855 AGGCAGGCAGGTCCGACAACTGG + Intronic
1033778514 7:144641584-144641606 AGGCAGGCAGGTGCCCCTGGAGG + Intronic
1033881249 7:145886835-145886857 AGACAGGCAGGTGCAGTAGCCGG + Intergenic
1034513181 7:151552914-151552936 AGGCAGGCAGGTGTGGAAGCTGG + Intergenic
1034866911 7:154649718-154649740 AGTCAGGCTGCTGCTCCTGCAGG - Intronic
1035245405 7:157559638-157559660 AGGCAGGCAAGTGCGCAGGCCGG + Intronic
1036453957 8:8892533-8892555 AGTCAGGCAGGTGCGCCAGCCGG + Exonic
1037800457 8:22031817-22031839 AGACAGGCAGGTGCAGGAGCTGG - Intronic
1041820393 8:62025573-62025595 AGCCAGACAGGTGGGCGAGCAGG - Intergenic
1049257790 8:141623153-141623175 AGTGGGGCAGGAGCGCCAGCTGG - Intergenic
1049698492 8:143995205-143995227 ACTCAGGCAGGGGCCACAGCTGG + Intronic
1050109544 9:2200459-2200481 TGTCAGGCTGGTGCTCCAGAGGG - Intergenic
1059951134 9:119463464-119463486 AGTCAATGAGGTGAGCCAGCAGG - Intergenic
1061715886 9:132518664-132518686 ACACAGGCAGGACCGCCAGCTGG - Intronic
1062717108 9:138016559-138016581 AGTCAGGTGGGTTCGGCAGCAGG + Intronic
1186033813 X:5398875-5398897 CCTCAGGCAGGTGCTCCAGGAGG + Intergenic
1186039186 X:5457453-5457475 AGACAGGCAGGTGCAGGAGCTGG + Intergenic
1186580876 X:10816916-10816938 ACTCAGCCAGGTGAGCCAGTGGG + Intronic
1192340989 X:70263212-70263234 AGCCAGGCAGGTGTGCCGGTTGG - Intergenic
1195702745 X:107716965-107716987 AGCCAAGCAGGCGCTCCAGCTGG + Intronic
1195962291 X:110398216-110398238 TGTCAGGCAGGTGAACCCGCTGG + Intronic
1198591476 X:138188099-138188121 TGTGAGGCAGGTGCTGCAGCAGG + Intergenic
1198853864 X:140995542-140995564 AGACAGGCAGGTGCAGAAGCTGG + Intergenic
1198878150 X:141249564-141249586 AGACAGGCAGGTGCAGAAGCTGG - Intergenic
1200710607 Y:6481566-6481588 AGACAGGCAAGTTCCCCAGCAGG + Intergenic
1201023326 Y:9680418-9680440 AGACAGGCAAGTTCCCCAGCAGG - Intergenic