ID: 1036454251

View in Genome Browser
Species Human (GRCh38)
Location 8:8893564-8893586
Sequence CGCGCTCCCGCCCGAGCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036454251_1036454259 3 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454259 8:8893590-8893612 GCCGCGTCCCCGGCGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 254
1036454251_1036454257 -1 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454257 8:8893586-8893608 GGGCGCCGCGTCCCCGGCGCTGG 0: 1
1: 1
2: 0
3: 33
4: 308
1036454251_1036454265 13 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454265 8:8893600-8893622 CGGCGCTGGGAGGGCGCGATTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1036454251_1036454258 0 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454258 8:8893587-8893609 GGCGCCGCGTCCCCGGCGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 185
1036454251_1036454261 4 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454261 8:8893591-8893613 CCGCGTCCCCGGCGCTGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 154
1036454251_1036454256 -7 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454256 8:8893580-8893602 GAGCGCGGGCGCCGCGTCCCCGG 0: 1
1: 2
2: 2
3: 33
4: 199
1036454251_1036454267 20 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454267 8:8893607-8893629 GGGAGGGCGCGATTGGGAAGCGG 0: 1
1: 0
2: 0
3: 17
4: 258
1036454251_1036454266 14 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454266 8:8893601-8893623 GGCGCTGGGAGGGCGCGATTGGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036454251 Original CRISPR CGCGCTCCCGCCCGAGCCCG GGG (reversed) Exonic