ID: 1036454251

View in Genome Browser
Species Human (GRCh38)
Location 8:8893564-8893586
Sequence CGCGCTCCCGCCCGAGCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036454251_1036454256 -7 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454256 8:8893580-8893602 GAGCGCGGGCGCCGCGTCCCCGG 0: 1
1: 2
2: 2
3: 33
4: 199
1036454251_1036454258 0 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454258 8:8893587-8893609 GGCGCCGCGTCCCCGGCGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 185
1036454251_1036454266 14 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454266 8:8893601-8893623 GGCGCTGGGAGGGCGCGATTGGG 0: 1
1: 0
2: 0
3: 9
4: 88
1036454251_1036454259 3 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454259 8:8893590-8893612 GCCGCGTCCCCGGCGCTGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 254
1036454251_1036454265 13 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454265 8:8893600-8893622 CGGCGCTGGGAGGGCGCGATTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1036454251_1036454267 20 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454267 8:8893607-8893629 GGGAGGGCGCGATTGGGAAGCGG 0: 1
1: 0
2: 0
3: 17
4: 258
1036454251_1036454257 -1 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454257 8:8893586-8893608 GGGCGCCGCGTCCCCGGCGCTGG 0: 1
1: 1
2: 0
3: 33
4: 308
1036454251_1036454261 4 Left 1036454251 8:8893564-8893586 CCCCGGGCTCGGGCGGGAGCGCG 0: 1
1: 0
2: 8
3: 20
4: 173
Right 1036454261 8:8893591-8893613 CCGCGTCCCCGGCGCTGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036454251 Original CRISPR CGCGCTCCCGCCCGAGCCCG GGG (reversed) Exonic
900162769 1:1232205-1232227 CGCGCACCGCCCCGAGCCGGCGG + Intergenic
900166381 1:1245728-1245750 CGCGGCCCCGCTGGAGCCCGAGG - Intronic
900349706 1:2228604-2228626 CGCGCCCCCGGGCGAGGCCGCGG + Intergenic
900633958 1:3652675-3652697 TGCGCTCCAGCCCCCGCCCGCGG - Intronic
901202561 1:7474985-7475007 CGCGCTCGCCCCTCAGCCCGTGG + Intronic
901642062 1:10697623-10697645 CTCTCTCCCTCCCGAGCCTGGGG + Intronic
905960035 1:42035745-42035767 CGCGCGTCAGACCGAGCCCGAGG + Intronic
920184589 1:204152081-204152103 CCCGCCCCCGCCCCGGCCCGCGG + Intergenic
920375252 1:205504747-205504769 CCCGCTCCCTCCCGGGCACGGGG - Exonic
920912505 1:210232442-210232464 CGGGCTCCCGCCCTAGCCCTGGG - Intergenic
921432943 1:215083624-215083646 CCCTCTCCCGCCGGTGCCCGGGG + Intronic
922834810 1:228619949-228619971 CGCGCTCGCACCCGCGCGCGCGG + Intergenic
922839831 1:228640054-228640076 CGCGCTCGCACCCGCGCGCGCGG + Intergenic
922840954 1:228644526-228644548 CGCGCTCGCACCCGCGCGCGCGG + Intergenic
1071291829 10:84194486-84194508 CGCCCTCCTGCCCCCGCCCGCGG + Intergenic
1071695374 10:87863892-87863914 CCGGCTCCCGCCCGAGCCCACGG - Exonic
1072788684 10:98302102-98302124 CGTGCCCCAGCCCGACCCCGTGG + Intergenic
1073217293 10:101843581-101843603 CCCGCTCCCGCCCGGGCCGTGGG + Intronic
1074843260 10:117375360-117375382 AGCGCGCCGGCCCGAGCCCCTGG - Exonic
1076374295 10:129973026-129973048 CGTGCTCGCGGCCGGGCCCGTGG - Intergenic
1076720334 10:132389623-132389645 CGCCCTCCAGCCCTAGCCCAGGG + Intergenic
1076908210 10:133373597-133373619 CCCGCCCCCGCCCCAGCCCTCGG + Exonic
1077356533 11:2121436-2121458 CACGCTCCTGTCCGACCCCGCGG + Intergenic
1078390276 11:10931105-10931127 CGCGCTCCAGCCCCCGCCCCGGG + Intergenic
1083572610 11:63768506-63768528 CGCGCTGCCGCTCGATCCGGCGG + Exonic
1083883262 11:65558550-65558572 CCCGCCCCCGCCGGAACCCGCGG + Intronic
1084153998 11:67303799-67303821 CGCCCTCCAGCCCGAGCCCCGGG - Intronic
1084178708 11:67436279-67436301 CGCGCTGCCACCCGAGCCCAAGG + Exonic
1084758379 11:71252733-71252755 CCCGCTCCCGCCCGCGGCTGCGG + Intergenic
1088812507 11:113401022-113401044 GGCTCTCCCGCCCCAGCCTGAGG - Intergenic
1096647584 12:53047173-53047195 CGCGCCCGCGCCCGCGCCCGTGG - Intronic
1102997410 12:117361054-117361076 CCCGCTCCCGCCCGAGCCCCTGG - Intronic
1103649645 12:122422645-122422667 CGCGCGCCCGCCCGGCCCCGCGG - Intergenic
1104049632 12:125186735-125186757 CGCGCGCCCGGCCCGGCCCGCGG - Intergenic
1105240976 13:18609540-18609562 CGCGCCCGCGCCCGCGCCTGTGG - Intergenic
1105378304 13:19864030-19864052 CCTGCCCTCGCCCGAGCCCGGGG + Intergenic
1106284164 13:28304694-28304716 CGCCCTCCAGCCCCAGCCCAAGG + Intronic
1108340698 13:49496103-49496125 CGCCCGCCCGCCCGCCCCCGCGG - Intronic
1112693024 13:101917061-101917083 CGCCCTCCAGCCGGCGCCCGGGG - Intronic
1113985849 13:114314808-114314830 CGCACTCCCGCCCCGGCCTGTGG - Intronic
1115850049 14:37583956-37583978 CCCGCGCCCCCCCGAGCCCAGGG + Intergenic
1117377479 14:55129396-55129418 CGCGCCCCGGCCCGGTCCCGGGG - Intronic
1118849472 14:69573068-69573090 CGCGCTCGGGGCCGAGGCCGCGG + Exonic
1119732817 14:76961865-76961887 CCCGCTGCGGCCCCAGCCCGCGG + Intergenic
1119756754 14:77125138-77125160 CCGGCACCCGCCAGAGCCCGCGG - Intronic
1119786885 14:77320817-77320839 CCCGCCCCGCCCCGAGCCCGGGG - Exonic
1120809850 14:88792520-88792542 GCCGCTCCCGCTCGGGCCCGCGG + Exonic
1129356485 15:74995534-74995556 CGCGCGCGCGCGCGCGCCCGAGG - Intronic
1129817238 15:78565695-78565717 CGCGGTCCCGCGCGGGCGCGGGG + Exonic
1130040765 15:80404130-80404152 CGAGCACCTGCGCGAGCCCGAGG + Intergenic
1136399874 16:30011443-30011465 CCCGCCCCCGCCCGCGCGCGCGG + Intronic
1137531639 16:49281967-49281989 CGCGCTCCCCACCGAGCCAATGG + Intergenic
1138327991 16:56191419-56191441 CGCGCGCGCGCCTGGGCCCGGGG - Intronic
1138923078 16:61556269-61556291 CGCGCTCCCTGCTGAGCCTGAGG - Intergenic
1139664514 16:68447097-68447119 CGCGCCCCCCGCCCAGCCCGCGG + Intronic
1140067933 16:71626257-71626279 CGCTCTCTCGGCCGGGCCCGGGG - Exonic
1141526922 16:84617782-84617804 CGAGGCCCCGCGCGAGCCCGGGG + Intronic
1141997963 16:87647208-87647230 CGCCCTCCCGGCCCAGCCCCTGG - Intronic
1142592812 17:1013811-1013833 TGGGCTCCAGCCCGAGCCTGGGG - Intronic
1142811953 17:2399656-2399678 CCCGCCCCCGGCCGAGCGCGAGG + Intronic
1143200703 17:5111484-5111506 CGGGCACCTGCCCGAGGCCGGGG - Intronic
1143373645 17:6455171-6455193 AGGGATCCTGCCCGAGCCCGGGG - Exonic
1144775633 17:17783288-17783310 CGCGCTGCCGGCAGAGCCCGAGG + Intronic
1144781565 17:17810797-17810819 CGCGCGTCCGCCGGAGCCGGAGG - Exonic
1144847007 17:18225429-18225451 CGCGAGCCCGGCCGAGCCCGGGG + Intergenic
1147150446 17:38510882-38510904 CTCGCAGCCGCCCGCGCCCGGGG + Exonic
1147200703 17:38799598-38799620 CGCCCTCCCGCCCCGCCCCGGGG + Exonic
1147617077 17:41836015-41836037 CGCGCGCCCGAGCGAGCCCCGGG - Intronic
1148664202 17:49362264-49362286 CGCGCGCCCGCGCGCGCCCGCGG + Intronic
1149296407 17:55265691-55265713 CCCGCTCCCGCCCTGTCCCGCGG + Intronic
1149461455 17:56833417-56833439 CCCGCGCCCGCCAGCGCCCGAGG - Intronic
1149994617 17:61400094-61400116 CGCGCCGCCGCCCGGGCCGGGGG + Exonic
1151662541 17:75526221-75526243 CGCGCTCCGGCCGCCGCCCGTGG - Intronic
1151825712 17:76523146-76523168 CGCGCTGCAGCCTGAGACCGAGG - Intergenic
1152049121 17:77958881-77958903 CGCGGGCCCGCCCGAGCCGGAGG + Intergenic
1152183748 17:78841160-78841182 CGCGCCCCCGCCCCAGAACGGGG + Intronic
1152349694 17:79777926-79777948 CCCGCCCCCGCCCCCGCCCGGGG + Intergenic
1152711195 17:81871163-81871185 CGCGCCCCGCCCTGAGCCCGCGG - Intronic
1154447990 18:14450368-14450390 CGCGCCCGCGCCCGCGCCCGTGG + Intergenic
1159586855 18:70289586-70289608 CGAGCCCGAGCCCGAGCCCGCGG - Intronic
1160242108 18:77131992-77132014 CGCGCTCCTGCCCCTGCCCCCGG - Intronic
1160766811 19:812515-812537 CGCGCGGCCGCCCGCGCCCTCGG + Exonic
1160930774 19:1568492-1568514 CGGGTTCCCGCCCGAGCGCCGGG - Intergenic
1161219172 19:3110143-3110165 CCCGCTCTCGCCCGTGCCTGGGG - Exonic
1161309390 19:3585651-3585673 TGCGCCCCCGCCCGCGCCCTCGG + Exonic
1161957720 19:7505897-7505919 CTCCCTCCCCCCCGGGCCCGGGG + Intronic
1162019674 19:7862824-7862846 CGCGGTCCCGCCCCTGCCCGCGG + Intronic
1162022583 19:7874429-7874451 GGCTCTCCCGCCCGCGGCCGAGG - Exonic
1162084513 19:8240493-8240515 CGTGCTCCCGCCTGAGCCTCTGG + Intronic
1162398397 19:10430925-10430947 GGCGTTCCTGCCCGAGCCCCTGG + Intronic
1163427013 19:17245514-17245536 CGCGCCCCCGCCGGGGCCCCAGG - Exonic
1164855501 19:31517654-31517676 GGTGCTCCCACCCCAGCCCGCGG - Intergenic
1165431458 19:35775745-35775767 CCCGGCCCCGCCCGATCCCGCGG + Intronic
1165902050 19:39173654-39173676 CGGCCTCCCACCCGAGCCCGAGG + Exonic
1166105697 19:40597136-40597158 CCCGCCCCCGCCCCCGCCCGAGG - Intronic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1168100288 19:54137894-54137916 CGCGATAGCGCCCGGGCCCGGGG + Intronic
926095693 2:10079827-10079849 CGCGTCCCCGCCCCAGCCCTGGG - Intronic
926217042 2:10912187-10912209 CGGGCGCCCGGGCGAGCCCGCGG - Exonic
927558082 2:24049891-24049913 CGGGCTCCCTCCGGAGCCAGGGG + Intronic
927652210 2:24919797-24919819 CGCGCTCCGGCCGGGCCCCGAGG - Exonic
927667452 2:25042333-25042355 CGCGCCCGGGCCCGGGCCCGCGG + Intronic
930872774 2:56184702-56184724 CGCGGCCCCGCCCGCGCCGGTGG + Exonic
932231515 2:70087605-70087627 CCCGCTCCCGCTCGCTCCCGCGG + Exonic
932380398 2:71276781-71276803 CGCGCTCTCGCCCGTGCTCTGGG + Intronic
935195918 2:100816206-100816228 CGCCCTCCCGCCTGGGCCAGAGG - Intergenic
935396928 2:102619426-102619448 CGCGCACCTGCCCGAGCCCGCGG - Intergenic
936600582 2:113890508-113890530 CGCGCCCCCGCCCCAGTCCCAGG - Intronic
938058241 2:128233029-128233051 CGCGCTCCCGCCTCGGCCCGCGG - Intergenic
938074014 2:128322475-128322497 CGCGCTCCGGCCGCTGCCCGGGG + Intergenic
942459111 2:176157423-176157445 CGCGCTCCCGCGCCCGCCGGGGG - Intronic
946029783 2:216694798-216694820 CGCTCTCCTGCCCCACCCCGAGG - Exonic
947745060 2:232503184-232503206 CGCGCTCCCGCCCCCGCCCGCGG + Intergenic
948728243 2:239947598-239947620 CGCCCTCCCCGCCGAGCCCCAGG + Intronic
1172773133 20:37393031-37393053 CCCGCTCCCGCCCAGGCCCAGGG + Intronic
1174287251 20:49482417-49482439 CTCGCTGCCGCCCGAGCCCATGG - Exonic
1175429313 20:58891108-58891130 CGGGCTGCTGCCCGAGCCCGGGG + Intronic
1175447274 20:59032022-59032044 CGCGCTCCCACGCGAGGTCGAGG + Intronic
1175715358 20:61251921-61251943 CGACTTCCCGCCCGGGCCCGCGG - Intergenic
1175859882 20:62144196-62144218 CGCGCTGTCCCCCGAGTCCGCGG + Intronic
1175877800 20:62238660-62238682 CCGGCTCCAGCCCCAGCCCGCGG - Intronic
1176078673 20:63260809-63260831 CTCGGTCCCGGCCGAGGCCGAGG - Intronic
1176173545 20:63707389-63707411 CGCGCTCCCGCCCTCCCCCGAGG + Intronic
1178485942 21:33020248-33020270 TGCCCTCCCGCCTGAGCCGGGGG - Intergenic
1180649964 22:17369522-17369544 CGCGCGCTCGCCCCATCCCGCGG - Exonic
1180733845 22:18001314-18001336 CCTGCTCGCGCCCGAGCTCGGGG - Intronic
1181491431 22:23262884-23262906 CTCGCTCCCGCCTCAGCCCCCGG - Intronic
1184090625 22:42291281-42291303 CGCGGTCCAGCCTGAGCCCCAGG + Intronic
1184465846 22:44668657-44668679 GGCGCCCCCGCGCGGGCCCGAGG + Intronic
1184663461 22:45976081-45976103 CGGGCCCCGGACCGAGCCCGAGG + Intronic
1185321292 22:50201252-50201274 CGCGCCGCGGCCCGTGCCCGGGG + Exonic
950729824 3:14947758-14947780 CCCGCTGCCCCGCGAGCCCGCGG + Intronic
950940413 3:16885162-16885184 AGCGCGCCCGCCCGTGGCCGAGG - Intronic
953925397 3:46980018-46980040 CGCGCGCGCGCCCGCGCGCGCGG - Intronic
953947586 3:47163392-47163414 CGAGCTTCCACCCGAGCCCGGGG + Intronic
958026667 3:88058442-88058464 CCCGCCCCCGCCCGAACCCCCGG - Intronic
967055481 3:185825548-185825570 CGCGCTCCCACCCGCGCCCGGGG - Intergenic
968008869 3:195260253-195260275 CGCGGTCCCTCCCCCGCCCGGGG - Intronic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
968434142 4:576307-576329 CGCGCCCCCTCCCCAGCCCGCGG + Intergenic
968556523 4:1248740-1248762 CGCGGTCCCGCCCCCGACCGCGG + Intronic
968585619 4:1414767-1414789 CGCGCCCCCGGCTGAGCCCAAGG + Intergenic
971195751 4:24471008-24471030 CGCGCTCCCTCCCGGGCCCGGGG - Intergenic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
974953964 4:68616213-68616235 CGGGCTCCAGACGGAGCCCGGGG - Intronic
975118702 4:70705592-70705614 CTCGCCCCCGCCCAAGCACGTGG - Intronic
981033805 4:140151449-140151471 CGAGCGCCGGCCCGAGCCCCCGG + Intronic
984778379 4:183504192-183504214 CGCGGTGCCGGGCGAGCCCGAGG + Intergenic
985784560 5:1887026-1887048 CCCGCTCCCGCCCCCGCCCCGGG - Exonic
986451447 5:7869353-7869375 CGAGCCCCAGCCCGCGCCCGCGG - Intronic
987379924 5:17275593-17275615 CGCGCTCTCGGCCGGGGCCGCGG - Exonic
992487594 5:77210885-77210907 CGCGCGCCCGCCCGCGCCCGCGG - Exonic
992866318 5:80960492-80960514 CACCCTCCCGGCCGAGCCCCCGG - Intergenic
997239150 5:132294279-132294301 CGCGCGCCCGCCCGCCCCCAAGG - Intronic
997543981 5:134689974-134689996 CGCCCTCCCCCCCCAGCCCCTGG - Intronic
998903223 5:146877875-146877897 CGAGCCCCCGCCCCAGCCCTAGG + Intronic
1001342721 5:170862233-170862255 CGGGCTCCGGCCCGGGCCTGGGG - Intronic
1001556811 5:172642152-172642174 CCCGCGCCCGCGCGTGCCCGTGG + Intronic
1002784965 6:393377-393399 CGCGCCCCCGCCGGCTCCCGAGG - Intronic
1005687309 6:28267236-28267258 CGCAGTTCCGCCCCAGCCCGGGG - Intronic
1005948866 6:30616504-30616526 CCCCCTCCCCCCTGAGCCCGAGG - Exonic
1006152545 6:31997073-31997095 CCCACCCCCGCCAGAGCCCGGGG - Intronic
1006158851 6:32029810-32029832 CCCACCCCCGCCAGAGCCCGGGG - Intronic
1006983025 6:38160931-38160953 CGCGCTCCTGCCCGTGTCCAAGG - Intergenic
1007701921 6:43770793-43770815 CGGGCTCCGGCCCCTGCCCGCGG - Exonic
1013272951 6:108559956-108559978 CACGATCCCGCGCGGGCCCGGGG - Intronic
1015149233 6:130019875-130019897 CGGGCTCCCGGCCCGGCCCGCGG - Intronic
1015561497 6:134520952-134520974 CGTGCTCCCTCCCAAGCCTGTGG + Intergenic
1019103134 6:169648290-169648312 CGTGCACACGCCCGAGCCCTGGG + Intronic
1019259369 7:72099-72121 CATGCTCCCTCCCGAGTCCGTGG - Intergenic
1020445268 7:8261786-8261808 CGCGCTCCGGCCCCAGCGCTGGG - Intronic
1022715164 7:32891912-32891934 CGCGCTCTCGCCCCCGCCCGCGG + Intronic
1025200065 7:56956595-56956617 CCCGGTCCCTCCCCAGCCCGTGG + Intergenic
1025671879 7:63620337-63620359 CCCGGTCCCTCCCCAGCCCGCGG - Intergenic
1026822150 7:73557172-73557194 CCCGCGCCCGGCCCAGCCCGGGG - Intronic
1029469515 7:100745358-100745380 CGTGCTCACGCCCGAGTCCAAGG - Intronic
1030347893 7:108455050-108455072 TCCCCTCCCGCCCGCGCCCGCGG - Intronic
1031966775 7:128032536-128032558 CGCCCTCCGGCCCGCACCCGGGG + Intronic
1036454251 8:8893564-8893586 CGCGCTCCCGCCCGAGCCCGGGG - Exonic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1037769311 8:21789442-21789464 CGCCCTGCCCCCCGAGCCCCCGG - Intronic
1042837851 8:73093356-73093378 CGCGCCCCAGCTCCAGCCCGGGG + Intronic
1045304817 8:100950638-100950660 CGCGCCCCCGCCCAAGCCGTGGG + Intronic
1045508517 8:102795326-102795348 CCCGCTCCTGCCAGAGCGCGGGG + Intergenic
1045583122 8:103500453-103500475 CGCGCTCCCGGCCCTGACCGCGG + Intergenic
1049269167 8:141685031-141685053 GGGGCTCCCGCCCAAGCCCTGGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049738608 8:144223209-144223231 CGCGCTGCCCCCCGAGCAGGAGG + Exonic
1052888900 9:33677216-33677238 CCGGCTCCCGCCCAAGCCCACGG + Intergenic
1056787784 9:89605243-89605265 CGCGCTCCCCTCCTACCCCGCGG - Intronic
1059309217 9:113376967-113376989 CGCACCTCCGCCCGAGCTCGCGG - Intronic
1059375408 9:113876657-113876679 TGGGCTCCGGTCCGAGCCCGGGG - Intronic
1061348089 9:130042877-130042899 CGCGCCCCCTCCCCAGGCCGCGG + Intronic
1061863431 9:133479247-133479269 CGCGGTGCCGGCCGCGCCCGGGG - Intergenic
1062042160 9:134409125-134409147 CGCGCCCCCACCCGACGCCGTGG - Intronic
1062435771 9:136546019-136546041 TGCGCTCCCTCCCGCGGCCGAGG + Intergenic
1189821601 X:44873851-44873873 CCCGTCCCTGCCCGAGCCCGAGG - Intronic
1192533681 X:71910949-71910971 CGCTCTCCGGCCCGCGCCCAGGG + Intergenic
1198518135 X:137428536-137428558 AGCGCTCCACCCCCAGCCCGGGG + Intergenic
1200250818 X:154552866-154552888 CACGCTCCTGCCCGCGCCCTGGG + Intronic
1200304263 X:155008493-155008515 CACGCTCCTGCCCGCGCCCTGGG - Intronic
1200374808 X:155768244-155768266 CGCGCGCGCGCCCAAGCGCGCGG - Intronic