ID: 1036454870

View in Genome Browser
Species Human (GRCh38)
Location 8:8897711-8897733
Sequence AAATAGCCTCAAGCCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036454860_1036454870 25 Left 1036454860 8:8897663-8897685 CCACCTTCTAGAACACACATGGT No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454856_1036454870 30 Left 1036454856 8:8897658-8897680 CCCCTCCACCTTCTAGAACACAC No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454864_1036454870 -6 Left 1036454864 8:8897694-8897716 CCCTGAATTCCCAATGCAAATAG No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454857_1036454870 29 Left 1036454857 8:8897659-8897681 CCCTCCACCTTCTAGAACACACA No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454865_1036454870 -7 Left 1036454865 8:8897695-8897717 CCTGAATTCCCAATGCAAATAGC No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454858_1036454870 28 Left 1036454858 8:8897660-8897682 CCTCCACCTTCTAGAACACACAT No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data
1036454861_1036454870 22 Left 1036454861 8:8897666-8897688 CCTTCTAGAACACACATGGTATG No data
Right 1036454870 8:8897711-8897733 AAATAGCCTCAAGCCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036454870 Original CRISPR AAATAGCCTCAAGCCTGGAT GGG Intergenic
No off target data available for this crispr