ID: 1036457940

View in Genome Browser
Species Human (GRCh38)
Location 8:8925940-8925962
Sequence AGGGTGGAGGGGGAGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457940_1036457950 5 Left 1036457940 8:8925940-8925962 CCATCTCTCTCCCCCTCCACCCT No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457940_1036457948 -2 Left 1036457940 8:8925940-8925962 CCATCTCTCTCCCCCTCCACCCT No data
Right 1036457948 8:8925961-8925983 CTTCCTCGTTGATGTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457940 Original CRISPR AGGGTGGAGGGGGAGAGAGA TGG (reversed) Intergenic
No off target data available for this crispr