ID: 1036457941

View in Genome Browser
Species Human (GRCh38)
Location 8:8925950-8925972
Sequence TCAACGAGGAAGGGTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457941_1036457950 -5 Left 1036457941 8:8925950-8925972 CCCCCTCCACCCTTCCTCGTTGA No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457941_1036457951 23 Left 1036457941 8:8925950-8925972 CCCCCTCCACCCTTCCTCGTTGA No data
Right 1036457951 8:8925996-8926018 AGATTTCTGTTCTTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457941 Original CRISPR TCAACGAGGAAGGGTGGAGG GGG (reversed) Intergenic
No off target data available for this crispr