ID: 1036457943

View in Genome Browser
Species Human (GRCh38)
Location 8:8925952-8925974
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036457943_1036457952 29 Left 1036457943 8:8925952-8925974 CCCTCCACCCTTCCTCGTTGATG No data
Right 1036457952 8:8926004-8926026 GTTCTTAGAAACAGGAGAAAAGG No data
1036457943_1036457950 -7 Left 1036457943 8:8925952-8925974 CCCTCCACCCTTCCTCGTTGATG No data
Right 1036457950 8:8925968-8925990 GTTGATGTTATACTGGATTTAGG No data
1036457943_1036457951 21 Left 1036457943 8:8925952-8925974 CCCTCCACCCTTCCTCGTTGATG No data
Right 1036457951 8:8925996-8926018 AGATTTCTGTTCTTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036457943 Original CRISPR CATCAACGAGGAAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr